ID: 1025132407

View in Genome Browser
Species Human (GRCh38)
Location 7:56383184-56383206
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 13, 1: 36, 2: 22, 3: 116, 4: 787}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132407_1025132419 23 Left 1025132407 7:56383184-56383206 CCAGCAACTCCCTGGCCTCCTCC 0: 13
1: 36
2: 22
3: 116
4: 787
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132407_1025132420 28 Left 1025132407 7:56383184-56383206 CCAGCAACTCCCTGGCCTCCTCC 0: 13
1: 36
2: 22
3: 116
4: 787
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132407 Original CRISPR GGAGGAGGCCAGGGAGTTGC TGG (reversed) Intergenic
900016081 1:151064-151086 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
900046345 1:509658-509680 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
900068546 1:751370-751392 CGAGGTGGCCAGGGAGTTGCTGG - Intergenic
900302579 1:1985558-1985580 AGAGGAGGCCAGGGAGTGCCAGG - Intronic
900413693 1:2525522-2525544 GTAGGAGAGCAGGGAGTGGCTGG + Intronic
900543471 1:3215717-3215739 GGAGGAGGGCAGGGGCTGGCAGG - Intronic
900619782 1:3581421-3581443 GGTGGGGGCCAGGGGGCTGCAGG + Intronic
900630830 1:3634286-3634308 TGAAGAGGCCAGTGAGTGGCTGG - Intronic
900673618 1:3870666-3870688 AGAGGAGGCCAAGGGGCTGCAGG + Intronic
900720411 1:4172281-4172303 GGAGGAGGTGTGGGAGCTGCAGG - Intergenic
900739986 1:4325068-4325090 GGAGGTGGCCAGGGAGATGCTGG + Intergenic
900798446 1:4723493-4723515 GGAGGTGGCCAGGAGGCTGCAGG + Intronic
901214471 1:7548260-7548282 GGAGGTGGCAAAGGAGCTGCTGG - Intronic
901251444 1:7783516-7783538 GGAGGAGCCCAGGGTGGGGCGGG - Intergenic
901390944 1:8945679-8945701 GGAGGAGATCAGGCAGGTGCTGG + Intergenic
901633995 1:10661218-10661240 GGAGGAGGCCAGGGGGTTGGAGG - Intronic
902256984 1:15195954-15195976 TGAGTAAGCCACGGAGTTGCAGG - Intronic
902571799 1:17351959-17351981 AGAGGCGGCCAGGGAGGTGATGG + Intronic
902571815 1:17352013-17352035 AGAGGCGGCCAGGGAGGTGATGG + Intronic
902632684 1:17714861-17714883 GAAGGAAGACAGGGAGCTGCCGG + Intergenic
902686443 1:18080613-18080635 GGAGGAGGCCAGGGTGCAGGAGG - Intergenic
903214852 1:21838335-21838357 GCAGGAGGCCATGGAAATGCTGG + Intronic
903785670 1:25859505-25859527 GAAGGGGGCCAGGGCCTTGCCGG - Intergenic
903847533 1:26287396-26287418 GGTGGAGGGCAGGTAGATGCTGG + Intronic
904194985 1:28778524-28778546 GAAAGGGGCCAGGGAGTTGATGG - Intergenic
904435044 1:30489400-30489422 GGTGGAGACCGGGGAGATGCAGG + Intergenic
904772176 1:32886547-32886569 GGATGAGGGCAGGGGGTTCCCGG + Intronic
905181916 1:36172495-36172517 GGAGAAGGCCAAGGCGCTGCGGG + Exonic
905284919 1:36873078-36873100 GGAGGAGGCCACTGAGTTGGAGG - Intronic
905328058 1:37171955-37171977 GGAGGAGCCCAGGGGGTCACAGG - Intergenic
905350964 1:37346168-37346190 GGAGGAGGGCAGGAAGGAGCTGG + Intergenic
905791826 1:40793747-40793769 AGAAGAGGGGAGGGAGTTGCAGG - Intronic
905885989 1:41492249-41492271 AGAGGGGGACATGGAGTTGCAGG + Intergenic
906220248 1:44072608-44072630 AGAGGATGCCCGGGAGTTCCAGG + Intergenic
906232940 1:44180915-44180937 GGAGGAGGGGAGGGGGTTCCAGG + Intergenic
906289363 1:44610001-44610023 GGAGGAGGGCAGGGAGGGGAGGG - Intronic
906325503 1:44843101-44843123 GGAGGAGTGCAGGGAGCTGCGGG + Intergenic
906696748 1:47828331-47828353 GGGGGACGCCAGGGACTTGGTGG - Intronic
907029700 1:51158303-51158325 GGAGGAGGGCAAGGAGATCCTGG - Intergenic
907038353 1:51236434-51236456 GGCGGCGGCCACGGAGCTGCTGG - Exonic
907243107 1:53091468-53091490 GGAGATGGCCAGGGGGCTGCTGG + Intronic
907319701 1:53594669-53594691 GGAGGAGGCTGGGGAGGTGGGGG + Exonic
907910800 1:58824564-58824586 GGTGGAGGCCAGGGGGTGGTAGG + Intergenic
908242095 1:62196218-62196240 TGAGGAGGCCAGGGAGGGGCCGG - Intronic
908523911 1:64969408-64969430 GGAGGAGGGTGGGGAGTTGCGGG - Intergenic
908850763 1:68373484-68373506 GGAGCAGGCCAGGGATGTCCAGG - Intergenic
910477079 1:87619361-87619383 GGAGGTGGGCAGGGAAGTGCTGG + Intergenic
911429961 1:97773383-97773405 GGAGAAGGGCAGGGAAGTGCTGG + Intronic
911654058 1:100423160-100423182 GGAGAAAGCCAGGCAGTGGCCGG - Intronic
912690923 1:111804158-111804180 GGCGGAAGCCAGGGAGGAGCTGG - Intronic
913256339 1:116957358-116957380 TGAGCAGGCCAGGGAGTGGGAGG + Intronic
915339308 1:155167554-155167576 GGAGGGGGGAAGGGAGTGGCGGG - Intergenic
915358876 1:155273528-155273550 GGCGGAGCCCAGGGGGTAGCTGG - Intronic
915526821 1:156481091-156481113 GGGAGGGGCCAGGGAGATGCTGG - Intronic
915737400 1:158093771-158093793 GCAGGAGGCCAGAGAGGAGCAGG - Intronic
916051950 1:161042527-161042549 GGAGGGGGCCAGGTGGCTGCAGG - Intronic
916729208 1:167551585-167551607 TGAGGTGACTAGGGAGTTGCTGG - Intronic
916939062 1:169661452-169661474 ACAGGAGCCCAGGGAGTTGGGGG - Intergenic
916940099 1:169668290-169668312 ACAGGAGCCCAGGGAGTTGGGGG - Intronic
917702303 1:177593863-177593885 GGTGGGGGGCAGGGAGTTGGAGG - Intergenic
917968850 1:180194769-180194791 GGAGGAGACCAGGTCGTTCCTGG + Intronic
918079291 1:181193317-181193339 GCTGGAGGCCAGGGAGTGGATGG - Intergenic
918719660 1:187836832-187836854 GGAGGAGAACAGGGAAGTGCTGG - Intergenic
919183826 1:194118512-194118534 GGAGGGGGCCAGGTAAGTGCTGG - Intergenic
919486840 1:198157022-198157044 GGAGGAGGATCGGGAGTCGCGGG + Exonic
919644107 1:200075728-200075750 GGAGGAGGGCAAAGAGCTGCTGG - Intronic
919746848 1:201014231-201014253 CGCGGAGGCCAGGGACATGCGGG + Intronic
919777856 1:201205903-201205925 GAAGGAAGCCAGGGTGTTCCAGG - Intronic
919818760 1:201459535-201459557 GGAGGAGGACAGTAAGGTGCAGG - Intergenic
920031207 1:203038492-203038514 GGGGGAGGAGAGGGAGGTGCTGG - Intronic
920244619 1:204578280-204578302 AGAGAAGCCCAGGGAGCTGCTGG + Intergenic
920322740 1:205137116-205137138 GGAGAAAGGCAGGGAGGTGCCGG + Intergenic
920897911 1:210075797-210075819 GAAGGAGGGCAGGGAAGTGCTGG - Intronic
921403466 1:214753106-214753128 GGAGGGGGTCAGGGAAGTGCTGG + Intergenic
921991628 1:221373022-221373044 GGAGGAGGGCAGGGAAGTGCTGG - Intergenic
922101591 1:222481821-222481843 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
922101648 1:222482124-222482146 GGAGGGAGCCAGGGAGTTGCTGG - Intergenic
922103902 1:222496742-222496764 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
922262672 1:223956937-223956959 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
922262728 1:223957240-223957262 GGAGGGAGCCAGGGAGTTGCTGG - Intergenic
922264223 1:223969273-223969295 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
922472353 1:225884070-225884092 GAAGGAGGACAGGCAGGTGCGGG - Intergenic
922696339 1:227732913-227732935 GGAGGAGGTCAGCGAGTGGAGGG - Exonic
922718188 1:227887585-227887607 GGACCAGGCCAGGGAGGTGAGGG - Intergenic
922802705 1:228371556-228371578 GGAGGCCGCCAGGGAGGAGCAGG + Exonic
923464660 1:234237524-234237546 GCAGGAAGGCAGGGAGATGCTGG - Intronic
923917440 1:238525129-238525151 GGCTGAGGCAAGAGAGTTGCTGG - Intergenic
924090497 1:240496283-240496305 GGAGGAGGCTGGTGAGATGCAGG - Intronic
924230491 1:241958279-241958301 GGAGGAGGCCAGGCTGGTGCAGG + Intergenic
924296787 1:242595387-242595409 GGAAGAGGCCAGGGACTGACTGG - Intergenic
924344511 1:243061938-243061960 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
924344566 1:243062241-243062263 GGAGGGAGCCAGGGAGTTGCTGG - Intergenic
924346072 1:243074266-243074288 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
924908784 1:248486304-248486326 GCAGGAGGGCAGGGAGATGCGGG - Intergenic
924915323 1:248561758-248561780 GCAGGAGGGCAGGGAGATGCGGG + Intergenic
1062787988 10:281267-281289 GGACGAAGCCATGGAGCTGCGGG - Exonic
1063376614 10:5558080-5558102 GGAGGTGGCCGGGGAGGGGCTGG + Intergenic
1064414488 10:15136588-15136610 GGAGAAGGGCAGGGTGTGGCCGG - Intronic
1064424910 10:15222062-15222084 GCAGAAGGCCAGGGAGAGGCTGG + Intronic
1064851604 10:19714629-19714651 GGAGGGGGACAGGGAAGTGCTGG - Intronic
1064911348 10:20405363-20405385 GGAGGGGGGCAGGGAGGTGAGGG - Intergenic
1065025042 10:21533934-21533956 GGAAGAGGCCTGGGAGGTGGCGG - Intergenic
1065207305 10:23369633-23369655 GGATGAGTCCAGAGAGTTGGAGG - Intergenic
1066181217 10:32962590-32962612 GGAGGGCGGGAGGGAGTTGCAGG - Intronic
1066730274 10:38430554-38430576 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1066731765 10:38442831-38442853 GGAGGGAGCCAGGGAGTTGCTGG + Intergenic
1066731822 10:38443134-38443156 GGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1066802400 10:39206299-39206321 GGAGGAGCCGAGGGAGCTGAGGG + Intergenic
1067346799 10:45443464-45443486 GGAGGAGGACCCGGAGCTGCAGG + Exonic
1068523459 10:58102925-58102947 AGAGCAGGCCAGGGGGCTGCCGG + Intergenic
1068607839 10:59025881-59025903 GAAGGAGGGCAGGGGATTGCTGG + Intergenic
1069106693 10:64392349-64392371 GCAGGAGGCCCAGGAGTTCCAGG - Intergenic
1069498921 10:68931929-68931951 GCAGAAGGCTAGGGAGTTCCTGG - Intronic
1069685095 10:70312811-70312833 GGAGGGGGCTAGTGAGGTGCAGG + Intronic
1069794379 10:71042884-71042906 GGAGCTGGCCAGGGAGCAGCTGG - Intergenic
1070045304 10:72828475-72828497 GGAGGAAGGGAGGGAGTGGCAGG - Intronic
1070145802 10:73772540-73772562 GGAGGAGGCGGGGGACTTGCCGG + Exonic
1070279406 10:75037835-75037857 GGAGGATGGCAGGGAGCTGTAGG - Exonic
1070327548 10:75398681-75398703 GGAGGAGTCCAGGGAGAGGCGGG - Exonic
1070720257 10:78752060-78752082 AGAGGAGGGCAGGGAGAGGCTGG - Intergenic
1070746289 10:78935933-78935955 GGAGGAGGCCAAGGGCTGGCAGG - Intergenic
1071016393 10:81002092-81002114 GAAGGAGGCAAGGGAGTGGAAGG - Intergenic
1071195348 10:83153243-83153265 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1072607980 10:96999746-96999768 GGCCCAGGCCAGGGAGTTGCTGG - Exonic
1072662736 10:97372683-97372705 GGAGCAGCCCAGGGAGCTGGAGG - Intronic
1072721659 10:97784750-97784772 CGAGGAGGACAGGGAATGGCAGG - Intergenic
1072799203 10:98381139-98381161 GGAGGAGGCCAGGGAGAGAGGGG - Intergenic
1073328303 10:102655241-102655263 GCAGGAGGCCAAGAAGCTGCTGG + Exonic
1073425102 10:103451434-103451456 AGAGGAAGCCAGGGAGTGGAGGG + Intronic
1073490180 10:103848196-103848218 GGAGGAGGAGAGGGAGCAGCAGG - Intronic
1073815691 10:107204192-107204214 GGAGGAGGGTAGGGGGTGGCGGG + Intergenic
1074178028 10:111030392-111030414 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1074323966 10:112429946-112429968 GGAAGAGGCCAAGCAGTTGTTGG + Intergenic
1074376704 10:112946844-112946866 GGAGGAAGGCAGGGAGAAGCTGG - Intergenic
1075182650 10:120225582-120225604 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1075199239 10:120388343-120388365 GGAGGGGGCCCGAGAGTTTCTGG - Intergenic
1075529205 10:123213340-123213362 GGAGGAGGCCAGGGGAATGCAGG - Intergenic
1076034888 10:127191246-127191268 GGAGGTGGCAAGGAAGTGGCAGG - Intronic
1076302966 10:129441841-129441863 GGAGGGGGAGGGGGAGTTGCAGG - Intergenic
1076333039 10:129685453-129685475 CGAGGAGGCCAGGAGGTGGCAGG - Intronic
1076411936 10:130257983-130258005 GCAGGAGGCCCTGGACTTGCTGG + Intergenic
1076532794 10:131155797-131155819 GGAGCAGCCCAGGGAGTGGGGGG - Intronic
1076555074 10:131316230-131316252 CGTGGAGGCCAGGGAGTCCCAGG - Intergenic
1076745214 10:132509569-132509591 AAAGGAGGCCTGGGTGTTGCCGG + Intergenic
1076972671 11:146131-146153 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1077093311 11:789150-789172 GGAGGAGGGCGGGGAGGGGCAGG + Intronic
1077487997 11:2847936-2847958 GTAGGTGGGCAGGGTGTTGCTGG - Exonic
1078171025 11:8929340-8929362 GGAGCACGCCAGGGAGATACTGG + Intronic
1078264932 11:9747990-9748012 GCAGGAGGCCATGGAGCAGCTGG + Exonic
1078511758 11:11989566-11989588 GGAGGTTGCCAGGGGATTGCAGG + Intronic
1078642270 11:13107894-13107916 CGAGGAGGCAAGAGAGTGGCAGG - Intergenic
1080015046 11:27495881-27495903 GGTGGAAGCCAAGGAGTTTCAGG + Exonic
1081181820 11:39993083-39993105 GCAGGAGGCAAGGGAGAAGCAGG - Intergenic
1081588306 11:44402852-44402874 GGAGGAGGCCAAGTAGATGGGGG - Intergenic
1081617976 11:44601640-44601662 GGAGGAGGCCAGAGCCATGCAGG - Intronic
1081793634 11:45805304-45805326 GGAGGCGTACAGGGAGCTGCCGG - Exonic
1082087064 11:48058864-48058886 TGAAGAGGCCAGGGAGCTGCCGG - Intronic
1082095598 11:48126965-48126987 AGAGGAGGACAGGGTGTTTCTGG + Intronic
1082261954 11:50083276-50083298 GGAGAAGGCCAGGGAGTTGCTGG - Intergenic
1083304373 11:61754912-61754934 AGAGAAGGCCTGGGAGTGGCAGG + Intronic
1083639592 11:64138290-64138312 GGAGGAGACCAGGCAGTGCCGGG - Intronic
1083687033 11:64382668-64382690 GGAGGAGGGGTGGGAGATGCTGG - Intergenic
1083920510 11:65779688-65779710 TGAGGAGGCGCGGGAGCTGCGGG - Exonic
1083923629 11:65793405-65793427 GGAGGAGGTCAGGGAGCCGCAGG - Intronic
1083932989 11:65856077-65856099 GGAGGAGGGCAAGGAGATCCTGG - Exonic
1084040270 11:66538750-66538772 TGAGGAGGCCAGAGAGGTGCAGG + Exonic
1084148961 11:67279237-67279259 GGAGGAGGCCAGGCCCTTGGTGG + Exonic
1084362386 11:68677478-68677500 GGAGGAGGACAGGCAGCTGGGGG - Intergenic
1084478013 11:69399963-69399985 GATGGAGGCCAGTGAGTTCCAGG + Intergenic
1084553504 11:69862952-69862974 CCAGGGGACCAGGGAGTTGCTGG - Intergenic
1084599495 11:70136436-70136458 GGGTGAGGCGAGGGAGGTGCTGG - Intronic
1085204736 11:74724562-74724584 GGAGGAGGCCTGGGGGCTGGTGG - Intronic
1085527342 11:77172092-77172114 GGAGGAGGGGCGGGAGCTGCCGG - Intronic
1085643607 11:78208736-78208758 GGAGGAGGCCAGGAAGTTTGAGG + Intronic
1085727524 11:78967164-78967186 GGGAGAGTCCAGGGAGTTGTGGG - Intronic
1087140079 11:94756352-94756374 GGAGGAGGGCAGGGAAGTGCTGG - Intronic
1087397043 11:97611747-97611769 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1087788869 11:102385670-102385692 GAAGGGGGCCAGGGAAGTGCTGG - Intergenic
1087901449 11:103646122-103646144 GGCTGAGGCAAGGGAATTGCTGG + Intergenic
1088123257 11:106394409-106394431 CGAGCAGGGCAGGGTGTTGCAGG - Intergenic
1088507381 11:110539696-110539718 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1088625998 11:111731218-111731240 GGAGGAGGGGAGGCAGATGCAGG + Intronic
1088651483 11:111961112-111961134 GGAGGAGCCCAGGAGTTTGCAGG + Intronic
1088972609 11:114787050-114787072 AGAAGAGGCCAGGGAGCTGCGGG - Intergenic
1089283074 11:117388032-117388054 GGAGGATGCTAGGGGGTTGGAGG - Intronic
1089283080 11:117388050-117388072 GGAGGATGCTAGGGGGTTGGAGG - Intronic
1089662510 11:119994548-119994570 GGAGAAGGCCAGAGACATGCTGG - Intergenic
1089906653 11:122046835-122046857 GGAGGAGGAGAGGGAGTAGGTGG + Intergenic
1090732036 11:129580472-129580494 GAAGGAGGCCAGTGAGGGGCCGG + Intergenic
1091256592 11:134192804-134192826 GGAGAAGGCCCTGGAGTTCCTGG - Exonic
1091754691 12:3043759-3043781 GGAGGGGGCCAGGGCATTCCAGG + Intergenic
1091791303 12:3273695-3273717 GGAGCAGGAGAGGGAGGTGCAGG - Intronic
1093850548 12:24031537-24031559 GAAGGAGGCTGGGGAGTTGCTGG + Intergenic
1093943912 12:25085719-25085741 GGAGGTGGGCAGGGAAGTGCTGG - Intronic
1094359074 12:29610245-29610267 GGACGAAGCCAGGGATGTGCTGG - Intronic
1094361670 12:29638052-29638074 GGAGGCGGGCAGGGAAGTGCTGG + Intronic
1094493692 12:30976686-30976708 GGAGGAGGTCAGGAAGTGGCGGG - Intronic
1094722080 12:33075571-33075593 GGTGGAGGGCAGGGAGATTCAGG - Intergenic
1095586976 12:43860499-43860521 GGAGGGGTCCAGAGAGTTCCCGG + Intronic
1095785164 12:46101836-46101858 GGAGGGGGACAGGGACGTGCTGG + Intergenic
1095926984 12:47588322-47588344 GGAGGAGGCCAGGAAGTGGTGGG + Intergenic
1096106961 12:49001697-49001719 GGAAGAGGCAAGGGATTTGTAGG + Intergenic
1096215909 12:49797216-49797238 GGAGGCCGCCAGGGGGTGGCAGG + Exonic
1096428000 12:51520649-51520671 TGAGGATGCCAGGAAGCTGCAGG + Intergenic
1096463091 12:51833582-51833604 TGAGGAGGCCAGGGTGTGGAAGG - Intergenic
1096558987 12:52422589-52422611 GGAGCAGGCCTGGGGGTTTCCGG + Intergenic
1097263415 12:57732442-57732464 GGAGCTGGGCAGGGACTTGCAGG + Exonic
1097293928 12:57943081-57943103 GGAGGAGGAAGGGGAGTTGAGGG + Intronic
1097352451 12:58563034-58563056 AGAGGAGGGCAGGGAAATGCTGG - Intronic
1098177951 12:67813395-67813417 GGTGGATGCCAGGGACTGGCAGG - Intergenic
1098288460 12:68933053-68933075 GGAGGAGGAGAGGGAGGCGCGGG - Intronic
1098826739 12:75306290-75306312 GGAGGAGGCCAGAGCTCTGCGGG + Intronic
1099204395 12:79711219-79711241 GCAGGAGCCCAGGGCGTTGGGGG - Intergenic
1099653207 12:85456379-85456401 GGAGGCGGGCAGGGAAGTGCTGG + Intergenic
1100017096 12:90024244-90024266 CCTGGAAGCCAGGGAGTTGCTGG + Intergenic
1100551792 12:95652879-95652901 GGAGGCATCCAGGGAGTTTCTGG + Intergenic
1101111138 12:101487280-101487302 GGAGGATGCCAGGGGGATGAGGG - Intergenic
1101379909 12:104205432-104205454 GTAGGAGGGCAGGGAAATGCTGG - Intergenic
1101675290 12:106911700-106911722 GGAGGGGCTCAGGCAGTTGCTGG + Intergenic
1101957433 12:109223363-109223385 GGAGGAGCCCAGCGCGCTGCAGG + Intronic
1102012698 12:109628469-109628491 GGAGGGGGCCAGGGAGGTGATGG + Intergenic
1102058268 12:109912991-109913013 GGAGGAGGCCAAGGAGATGTGGG + Exonic
1102240961 12:111324428-111324450 GGAGGGGGCCAGGAAGAGGCAGG + Intronic
1102546990 12:113664410-113664432 GGAGCAGGCCTGGGGGTTGGGGG + Intergenic
1102953338 12:117044502-117044524 GAAGGAGGGCGGGGAGTTGGGGG + Intronic
1102955894 12:117058884-117058906 GGAGGAGGGCAGGCAGGTGAGGG - Intronic
1103443544 12:120980016-120980038 GGTGGAGGTCAGGGAGCCGCTGG - Intronic
1103522265 12:121544209-121544231 GGAGGAGTCCTGGGAGTTTAAGG + Intronic
1103582934 12:121929614-121929636 GGTGGAGGACAGGGGGTTTCAGG - Intronic
1103613572 12:122138498-122138520 GGAGGAGGCCCGGCGGCTGCGGG + Exonic
1103804594 12:123562656-123562678 GGAGAATGCCAGGGAGGTGAGGG + Intergenic
1103976828 12:124708060-124708082 GGAGGAGGGCTGGGAGTGGATGG - Intergenic
1104231795 12:126892036-126892058 GGAGGGAGCCAGGGAGATGAGGG - Intergenic
1104312252 12:127663913-127663935 GGAGGATGCCAGGCAGAGGCTGG - Intergenic
1104670267 12:130675494-130675516 GAAGGAGGCCTGGGCATTGCAGG - Intronic
1104759205 12:131287036-131287058 GGTGGAGGCCAGGGAGGGGCAGG - Intergenic
1104770196 12:131356713-131356735 GGAGCAGGCCAAGGAGAAGCAGG + Intergenic
1104821406 12:131679460-131679482 GGTGGAGGCCAGGGAGGGGCAGG + Intergenic
1105377913 13:19862547-19862569 GTAAGAGGCCAAGGAGTTCCTGG + Intronic
1105378346 13:19864155-19864177 GGGCGAGGCCGGGGAGGTGCTGG + Intergenic
1105429694 13:20325762-20325784 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1105818875 13:24062350-24062372 GCAGGAGGCCAGGGACTGACTGG + Intronic
1106218822 13:27727565-27727587 GGAGGAGGAGAGGGAGGAGCAGG + Intergenic
1107229010 13:38086144-38086166 GAAGGAGGCCAGGGGGCTGAGGG + Intergenic
1108278482 13:48836452-48836474 GGCTGAGGCCAGAGAATTGCTGG - Intergenic
1108617210 13:52145276-52145298 GGAGCAGGCCTGGCAGTTTCTGG - Intronic
1108708085 13:53008056-53008078 GCAGGAAGCCAGGGAGTTGGTGG + Intergenic
1108868135 13:54947225-54947247 GGAGGAGGCTATGGGGTTTCTGG + Intergenic
1109083362 13:57936931-57936953 TGAGGAGGCCACAGAGTTGGAGG - Intergenic
1109378596 13:61527054-61527076 GGAGGGGGACAGGGAAGTGCTGG - Intergenic
1110155470 13:72311464-72311486 GTTGGAGGACAGAGAGTTGCAGG + Intergenic
1110164991 13:72431071-72431093 GAAGGAGGTGAGGGATTTGCTGG + Intergenic
1110385650 13:74907239-74907261 GGAGGAGGGCAGGGAAGTGCTGG - Intergenic
1110613888 13:77520046-77520068 GGAAGATGCCAGGAAGTTTCAGG + Intergenic
1111206655 13:85020072-85020094 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1112058868 13:95716971-95716993 GGAGGGGGGCAGGGAAGTGCTGG - Intronic
1112506928 13:99981137-99981159 GGAGGAGGCGGGGGAGTAGGGGG - Intergenic
1112941322 13:104866134-104866156 GGAGGCGGGCAGGGAAGTGCTGG + Intergenic
1113585815 13:111463738-111463760 GGAGGAGGGCAGAGAGCTGCCGG - Intergenic
1114266385 14:21074808-21074830 GGAGGAGGCCAGGGGGCTGAAGG + Exonic
1115447316 14:33506077-33506099 GGAGGAGGATAGGGAGTGGCAGG - Intronic
1116345447 14:43786827-43786849 GGAGGAGGGCAGGGAAATGCTGG - Intergenic
1116984282 14:51203375-51203397 GCAGGTCCCCAGGGAGTTGCAGG - Intergenic
1117027496 14:51636542-51636564 GGAGGAGGCTAGGGAGTCCAGGG - Intronic
1117057847 14:51931218-51931240 GGAAGAGTCCAGGGGTTTGCTGG + Intronic
1117565485 14:56990351-56990373 GGCAGATGACAGGGAGTTGCTGG - Intergenic
1119434845 14:74591607-74591629 TGAGGAAGCCAGGTAGTTCCAGG - Intronic
1119760349 14:77146420-77146442 GGAGGAGGCTCGGGAGGAGCAGG + Intronic
1120145886 14:80978055-80978077 GGAGGAGGCAAGGAAGATGAAGG - Intronic
1120211971 14:81642048-81642070 GGAGCAGGGCAGGGAAGTGCTGG - Intergenic
1120850190 14:89162813-89162835 GGAGGAGGAGATGGAGTCGCTGG + Exonic
1121029265 14:90644124-90644146 GCAGGAGGGCAAGGAGGTGCAGG + Exonic
1121040625 14:90743860-90743882 GGATGGGGCCAGGGAGGTGGAGG - Intronic
1121161377 14:91744437-91744459 TGAAGAGGGCAGGGAATTGCAGG + Intronic
1121477532 14:94224627-94224649 GGAGGAGGCCCAGGTGTTACAGG + Intronic
1122363407 14:101180762-101180784 GGAGCAGGGAAGGGAGGTGCAGG - Intergenic
1122388517 14:101364917-101364939 GGCGGAGGCCAGTGAGCGGCAGG + Intergenic
1122546304 14:102524608-102524630 GGAGGAGCCCAGGCAGCCGCAGG - Intergenic
1122601846 14:102925458-102925480 GGAGGAGGGCAGGGAGAGGGAGG + Intronic
1122840713 14:104461491-104461513 AGAGGAGCCCTGGGAGCTGCGGG + Intergenic
1122924060 14:104891775-104891797 GCAGGAGGCCAGGGAGTGCTGGG + Intronic
1123644359 15:22428302-22428324 GTGGGAGGCCAGGGCGTGGCAGG - Intergenic
1123787223 15:23686302-23686324 GGAGGAGGCCAGAGCTCTGCGGG - Exonic
1124045007 15:26140605-26140627 GGAGGAGGCAAGAGAGAGGCGGG - Intergenic
1124109535 15:26773174-26773196 GGAGGAGGCCGGAGAGTCGGAGG + Intronic
1124166923 15:27335654-27335676 GGAGGGGACCAGGGAGTGGGGGG + Intronic
1124201726 15:27684311-27684333 AGCTGAGGCCAGGGAGTTACAGG - Intergenic
1124368826 15:29091810-29091832 GGAAGAGGTCAGGAGGTTGCTGG + Intronic
1124668461 15:31615755-31615777 GGAAGAGGACAGGGAATTGTAGG + Intronic
1125535484 15:40439586-40439608 GGAGCAGCCCAGGGAGGGGCTGG - Intergenic
1125891967 15:43273719-43273741 GGAGGAGGGGAGGGGGTTGGGGG + Intergenic
1125893917 15:43286330-43286352 GGAGGAGGCCTGGGATGAGCAGG - Intronic
1126278788 15:46918569-46918591 GGAGGGGGACAGGGAAGTGCTGG + Intergenic
1127390939 15:58504576-58504598 GGAGAAGGCCAGGTCGATGCTGG - Intronic
1127995963 15:64153265-64153287 GGAGGTGCCCAAGGAGTTACTGG + Exonic
1128999241 15:72319373-72319395 GGTGGAGGCCAGGAATTTGGAGG + Intronic
1129109882 15:73331093-73331115 GGAGGAAGCCTGGGAGAGGCAGG + Intronic
1129161563 15:73750977-73750999 GGAGGTGGCCAAGGAGCTGAGGG - Exonic
1129185904 15:73906303-73906325 GGAGGAGGTCGGGGAGAGGCTGG + Intergenic
1129222089 15:74136836-74136858 GGAGGAGGCCTGGGCGATGAAGG + Intronic
1129458305 15:75687423-75687445 GGAGAAGGCCATGGTGTCGCGGG + Exonic
1129747794 15:78037175-78037197 TGAGGAGGCCAGGGACTCCCAGG - Intronic
1130247856 15:82269623-82269645 GGAAGAGGCTAGGGAGATGAGGG + Intronic
1130273511 15:82464638-82464660 TGAGAAGGCCAGGGTGTTGCGGG - Intergenic
1130465864 15:84192009-84192031 TGAGAAGGCCAGGGTGTTGCAGG - Intergenic
1130486837 15:84402816-84402838 TGAGAAGGCCAGGGTGTTGCGGG + Intergenic
1130498401 15:84481527-84481549 TGAGAAGGCCAGGGTGTTGCAGG + Intergenic
1130588151 15:85196605-85196627 TGAGAAGGCCAGGGTGTTGCGGG - Intergenic
1130871465 15:87975497-87975519 GCAGGAGGTCAGGGAGCTGCAGG + Intronic
1130927422 15:88396059-88396081 GGAGGAAGGCAGGGAAGTGCTGG - Intergenic
1131154759 15:90067881-90067903 GCAGGAGGCCAGTGAGTTCGAGG + Exonic
1131557824 15:93414620-93414642 GGAGGAGGACAGGGAAGTGCTGG - Intergenic
1132124479 15:99210563-99210585 GGAGCAGGCAAGGGAGAAGCAGG + Intronic
1132723232 16:1327219-1327241 AGAGCAGGCCAGGGAGGTGCAGG - Intergenic
1132732921 16:1371719-1371741 GCAGAAGGCGTGGGAGTTGCTGG + Intronic
1133129182 16:3665701-3665723 GGTGCAGCCCAGGGAGTGGCAGG - Intronic
1133257257 16:4524698-4524720 GGAGGTGGTCAGTTAGTTGCTGG - Intronic
1133258445 16:4533229-4533251 GGAGGTGGCCAGGGAATTCTGGG + Intronic
1133393595 16:5428729-5428751 AGAGGAGGCCAGGAGGTTTCTGG + Intergenic
1133866187 16:9645865-9645887 AGAGGAAGCCAGAGAGTTGGAGG - Intergenic
1134187797 16:12098180-12098202 GGAGGAGGAAAAGGAGTTGAAGG - Intronic
1134314720 16:13108065-13108087 GTAGGAGGACAGGGAGTGGAGGG + Intronic
1134452787 16:14373669-14373691 GGGGGAAGGCAGGGAGCTGCTGG - Intergenic
1134631933 16:15762647-15762669 GGGGGAGGCCAGTGAGTTGGGGG - Intronic
1135085062 16:19468642-19468664 GCAGGAGGTCAGAGAGTAGCAGG + Intronic
1136004084 16:27316419-27316441 GGAAGAGGGCAGGGAGATGGGGG - Intronic
1136398731 16:30006549-30006571 GAGGGAGGCCAGGGAGGGGCTGG - Intronic
1136496962 16:30650820-30650842 GGGGGAGGGCAAGGAGTGGCTGG + Intronic
1136598749 16:31269846-31269868 GGAGGAGGGCAGTGAGGTCCGGG - Intronic
1136861495 16:33707055-33707077 GGCGAAGGCCAAGGAGGTGCCGG - Intergenic
1136913639 16:34162583-34162605 GGGGGAGGCGAGGGAGGGGCGGG - Intergenic
1137027506 16:35492533-35492555 GGCGGTGGCCAGGGAGTGACTGG + Intergenic
1137756275 16:50904800-50904822 GGAGGGGGCCAGGTGTTTGCAGG + Intergenic
1137898392 16:52238274-52238296 GGAGGAGGCCATGGAGCAGTGGG + Intergenic
1138395074 16:56697783-56697805 AGAGGATGCCAGGGAGCTGCTGG + Intronic
1139284388 16:65797715-65797737 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1139303971 16:65967722-65967744 GGAGGAGGCCAGGAAGAAGCAGG - Intergenic
1139354327 16:66358343-66358365 GGAGCTGGCCAGGCAGTTCCAGG + Intergenic
1139354817 16:66361205-66361227 GGAGGAGGCCAGGTGGTAGAGGG - Intergenic
1139354867 16:66361413-66361435 GGAGGTGGCCTGGGAGCTGCCGG - Intergenic
1139663574 16:68439336-68439358 GGAGGAGACCAGGGTCTGGCTGG - Intronic
1140126822 16:72124814-72124836 GGAGCAGCTCAGGGAGTTCCAGG - Exonic
1140229837 16:73108637-73108659 GGAGGGGGCCAGAGAGGTACTGG - Intergenic
1140798614 16:78464257-78464279 GGAGGATGACAGGGAGATGGAGG + Intronic
1141509688 16:84504480-84504502 GTGGGAGGCCAGGGAGGGGCAGG + Intronic
1142008206 16:87700465-87700487 GGAGGAGGGCAGGGGGTAGAGGG + Intronic
1142024928 16:87807273-87807295 GGAGGAGGGCAGGGAGGTTGGGG + Intergenic
1142105781 16:88301924-88301946 GGAGGAGGGCCTGCAGTTGCTGG - Intergenic
1142120935 16:88386396-88386418 GGAGAAGGGCAGGCAGTCGCCGG - Intergenic
1142359203 16:89618927-89618949 GCAGGGGGGCAGGGAGCTGCAGG - Intronic
1142359247 16:89619019-89619041 GCAGGGGGGCAGGGAGCTGCAGG - Intronic
1142359274 16:89619080-89619102 GCAGGGGGGCAGGGAGCTGCAGG - Intronic
1142359468 16:89619504-89619526 GCAGGGGGGCAGGGAGCTGCAGG - Intronic
1142447578 16:90151391-90151413 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1203122995 16_KI270728v1_random:1555246-1555268 GGCGAAGGCCAAGGAGGTGCCGG - Intergenic
1142459915 17:83932-83954 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1142682997 17:1561560-1561582 GGAGAAGGCCGGGAAGTTACCGG - Intronic
1142694008 17:1623508-1623530 GGAGGAAGCCAGGGAGATAGAGG - Intronic
1142717290 17:1754263-1754285 GAAGGAGGACAGGGACATGCGGG - Exonic
1142805151 17:2367560-2367582 GAAGGAGGCCAGACAGGTGCTGG + Intronic
1143270843 17:5673373-5673395 GGTGGGGGCCAGGGGGCTGCAGG + Intergenic
1143472378 17:7184022-7184044 GGAGGGGACCAGGGAGGTGGGGG + Intergenic
1143537185 17:7548678-7548700 GGAAAAGGGCAGGGAGTTCCAGG - Intergenic
1143683316 17:8493762-8493784 GGAGGAGGCCAGGAAGAACCTGG - Exonic
1144208012 17:12992943-12992965 GGAGGAGCGCAGGGAGAAGCGGG - Exonic
1144470446 17:15535497-15535519 GGAAGGAGCCAGGGAGTGGCAGG - Intronic
1144783046 17:17817344-17817366 CAAGGAGGCCAAGGGGTTGCAGG + Exonic
1144925895 17:18808175-18808197 GGAAGGAGCCAGGGAGTGGCAGG + Intergenic
1144955490 17:19016965-19016987 TGAGGAGGCCAGGAAGTAGTGGG - Intronic
1145012072 17:19374226-19374248 GGAGGCTGTCAGGGAGTGGCAGG + Intronic
1145210362 17:21008619-21008641 GGAGGAGGCACTGGAGATGCTGG + Intronic
1145274908 17:21423461-21423483 GGTGGAGGCCGGGGAGGAGCTGG - Intergenic
1145884441 17:28372329-28372351 GGAGGAGGCCTGGCTGCTGCCGG + Exonic
1146126891 17:30237395-30237417 GGAGGGGTACAGGGAGTTGCTGG + Intergenic
1146260498 17:31417264-31417286 GGAGGAGGTGAGGCAGGTGCTGG - Intronic
1146502422 17:33375412-33375434 AGAAGAGGTCAGGGAGGTGCAGG + Intronic
1147125436 17:38364811-38364833 GGAGGAGGAGGGGGAGTTGGAGG - Exonic
1147135541 17:38431924-38431946 AGGGGAGGGCAGGGAGCTGCAGG + Intronic
1147225691 17:38975379-38975401 GGGTGAGGCCAGAGAATTGCTGG - Intergenic
1147376224 17:40023774-40023796 GGAGGAGGCCAGGGCTGGGCGGG - Intronic
1147384680 17:40074279-40074301 GGGAGGGGCCAGGGAGTGGCAGG - Exonic
1147498008 17:40936460-40936482 GGTGAAGGACAGGGAGATGCGGG + Exonic
1147864959 17:43546027-43546049 GGAGGGGGCGCGGGAGTTGTGGG - Intronic
1147999505 17:44379653-44379675 GGGACAGGCCAGGGAGGTGCAGG - Intronic
1148205760 17:45778935-45778957 GGATGAGGCTGGGGGGTTGCAGG - Intergenic
1148806390 17:50266170-50266192 GGAGGAGGACCGAGAGTGGCAGG - Intergenic
1149038463 17:52159320-52159342 GGAGGGAGGCAGGGACTTGCAGG - Intronic
1149132246 17:53316483-53316505 GGAGGTGGCCAGAGAAGTGCTGG - Intergenic
1149217169 17:54370582-54370604 GGAGGGGGACAGGGAAGTGCTGG - Intergenic
1149651790 17:58280394-58280416 GGAGGAGGCCAAGCAGCTGGTGG - Exonic
1149656670 17:58312729-58312751 GGAGGAGGACAGGAAGGGGCAGG + Intronic
1149882533 17:60307648-60307670 GGAGCAGGGCAGGGAAGTGCTGG + Intronic
1150353520 17:64464205-64464227 GGAGGAGGCCTGGGAGGTCAAGG - Intronic
1150444905 17:65221254-65221276 GGAGGAGGGCACAGAGTTGGGGG + Intronic
1151310300 17:73288667-73288689 GGAGGAGAGGAGGGAGGTGCTGG - Intronic
1151705436 17:75764771-75764793 GGAGGAAGCGAGGAAGTGGCCGG - Intronic
1152290516 17:79437391-79437413 TGACGAGCCCAGGGAGGTGCGGG + Intronic
1152362639 17:79839626-79839648 GGAGGGCGCCGGGGAGGTGCAGG + Intergenic
1152773875 17:82187768-82187790 GGAGTGGGGCAGGGAGTTGGCGG + Intronic
1153365517 18:4251367-4251389 AGAGGAGGTCAGTGAGTTGCGGG + Intronic
1153932207 18:9887868-9887890 GAAGGAGGCCGGGGAGAGGCTGG + Exonic
1154178862 18:12112007-12112029 GGCTGAGGCAAGAGAGTTGCTGG + Intronic
1154202524 18:12308913-12308935 GGAGGAGCGAAGGGAGTGGCCGG - Intronic
1154299551 18:13181162-13181184 GGTGGGGGGCAGGGAGATGCTGG - Intergenic
1154333397 18:13447969-13447991 GGGGGAGGCCAAGGGGTGGCCGG + Intronic
1154472859 18:14721882-14721904 GGAGGAGGCCAGGGAGTAGCTGG + Intergenic
1154974938 18:21448282-21448304 GGTGGAGGCCAGGGAGAGGTAGG - Intronic
1155437782 18:25831225-25831247 GGAGGAGGACAGGGTGTTATGGG + Intergenic
1156371706 18:36477119-36477141 GGAGGAGGACAGGGACATCCAGG + Intronic
1156439346 18:37167862-37167884 GGAGGGGGGCAGGGAAGTGCAGG - Intronic
1156900160 18:42291104-42291126 AGTGGAGGCCAGGGAGTCACAGG + Intergenic
1157535104 18:48452149-48452171 GGACGGGGCCAGGGAAATGCTGG - Intergenic
1157855334 18:51100103-51100125 GGAGGGGGACAGGGAAGTGCTGG + Intergenic
1158606483 18:58900619-58900641 GGAGGAGGACAGGGAGGGGCAGG - Intronic
1158692023 18:59669402-59669424 GGAGGAAGCCAAGGAGCTGTTGG - Intronic
1159328125 18:66949917-66949939 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1160143654 18:76347572-76347594 GGAGGAGGCTGGGGAGGAGCAGG - Intergenic
1160649630 19:216440-216462 CGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1160816845 19:1040021-1040043 GGAGCAGGCCAGTGAGTGACGGG + Intergenic
1160909448 19:1468025-1468047 GGAGGAGCTCAGGGAGTAGCAGG - Exonic
1160949602 19:1659058-1659080 GGAGGTGGGCAGGGACTTTCGGG - Intergenic
1161151292 19:2711428-2711450 GAAGGATGCCAGGGGGTTACGGG - Intergenic
1161428644 19:4217929-4217951 GGAGGAGGCCCTGGAGCTGCGGG + Exonic
1161560859 19:4971747-4971769 GGAGGAGGCGAGGCTGTTGAGGG + Intronic
1161687167 19:5708500-5708522 GGCGGAGGGGAGGGAGTTGATGG - Intronic
1162311391 19:9909532-9909554 GGAGGAAGCCAGAGAGAAGCAGG + Intronic
1162331288 19:10031343-10031365 GGAGTTGGTCAGGGAGTTTCGGG + Intergenic
1162494547 19:11016144-11016166 GGAGGAGGCGAGGGAGGCGGGGG + Intronic
1162789102 19:13053929-13053951 GGAGGTGTCCAGGGAGTGGATGG - Intronic
1162893065 19:13747943-13747965 GGAGGAGGGCAGGTAAGTGCCGG + Intronic
1162998517 19:14351399-14351421 GGAGGAAGGCAGGGAGATGAGGG - Intergenic
1163229469 19:15990480-15990502 GGAGGAAGCCTGTGAGTTGGGGG - Intergenic
1163368539 19:16889372-16889394 GGGGGAGGCCGGGAAGTTGCGGG + Intronic
1163442698 19:17329647-17329669 GGAGGAGGGGAGGGAGGGGCTGG + Intronic
1163620508 19:18356935-18356957 GGCGGAGGCCAGAGAATCGCTGG + Intronic
1163672249 19:18636308-18636330 GGAGGGGGCGAGGGATTGGCGGG - Intergenic
1163679068 19:18670148-18670170 AGGGCAGGCCAGGGAGTGGCAGG - Exonic
1164063576 19:21695351-21695373 GGAGGAGCCGAGGGAGCTGAGGG + Intergenic
1164448372 19:28337066-28337088 GGAGGAAGGGAGGGAGTTGAGGG + Intergenic
1164615420 19:29664550-29664572 GGAGGAGGCCAGGGAGGGCCAGG + Intergenic
1164677635 19:30112352-30112374 GGAGGTGTCCAGGGTGCTGCTGG + Intergenic
1165404757 19:35622802-35622824 GGAGCAGGCCATGGTTTTGCAGG + Intronic
1165700577 19:37933957-37933979 GGGGGAGGCCAGGGAGTGCCTGG + Intronic
1165837645 19:38769663-38769685 TGAGGAGGCCTGGGAGAGGCCGG - Intronic
1165855606 19:38878014-38878036 GGAGGTGGGCAGGGAGGCGCAGG + Intronic
1166286700 19:41835183-41835205 GGAGGAGGCAAAGGAGTGGATGG + Intergenic
1166396090 19:42442332-42442354 GGCTGAGGCCAGAGAATTGCTGG - Intronic
1166547137 19:43640193-43640215 GGAGGGTGGCAGGGTGTTGCTGG + Intergenic
1166673036 19:44722874-44722896 GGAGGAGCCCAGGAGGCTGCAGG + Intergenic
1166805688 19:45485647-45485669 GGAGGGGGCCAGAGGGCTGCGGG + Exonic
1167011907 19:46814044-46814066 GGATGAGGGCAGAGAGTTCCAGG - Intergenic
1167056125 19:47112493-47112515 GGAGGAGGCGAAGGCGTTGATGG + Exonic
1167272143 19:48511659-48511681 GGAGGAGGCCAGGGTCGCGCGGG - Intronic
1167334244 19:48874785-48874807 GGAGGAGCCCAGGGAGGCGGTGG - Exonic
1167335568 19:48883639-48883661 AGAGGAGGCCAGTGGGTTGCAGG - Intronic
1167358051 19:49016076-49016098 AGAGGAGGCCTGAGAGTTGGGGG + Exonic
1167486794 19:49767440-49767462 GGAGGAAGCCAGTGAGGTCCCGG + Intronic
1167576500 19:50320361-50320383 GGAAGAGGCCAGAGAGTTGGGGG + Intronic
1167623268 19:50570142-50570164 GGCGAGGGCCAGGGAGTGGCAGG + Intergenic
1168211458 19:54893786-54893808 AGAGCAGGCCAGGGGGCTGCCGG - Intergenic
1168720590 19:58552629-58552651 AAAGGAGCCCAGGGAGTTGGTGG - Intronic
1202646240 1_KI270706v1_random:144638-144660 GAAGGAGGCCAGGGAGTTGTTGG - Intergenic
924985432 2:265107-265129 GGAGGAGGCCAGGGACTGGGAGG + Intronic
925055799 2:856486-856508 GGAGGAGAGCAGGAAGTTCCTGG - Intergenic
925092438 2:1166598-1166620 GGAGGGGGGCAGGGAAGTGCTGG + Intronic
925164763 2:1709235-1709257 GGAGGAGGCCAGGCACCAGCAGG + Intronic
925204635 2:1995786-1995808 GGAGGAGGCCAGCGTGTAGTGGG + Intronic
925294121 2:2766557-2766579 GCAGGAGGCCCGGGAGGAGCTGG - Intergenic
925648969 2:6068624-6068646 TGTGGAGTCCAGGGAGTTGGGGG + Intergenic
925739404 2:6992564-6992586 GGAGGAGAGCAGGGACTTGCTGG + Intronic
925957047 2:8977030-8977052 GATGGAGGCCAGGGAGAGGCAGG + Intronic
926168292 2:10535149-10535171 GGAGGAGGGCAGGGCCTGGCTGG - Intergenic
926323667 2:11766207-11766229 GGAGGAAGACAGGCAGATGCTGG + Intronic
926324375 2:11771647-11771669 GGATGAGGCCATGGAGCTGCTGG + Exonic
926784182 2:16503789-16503811 GTAGGAGGAAAGGGAGTTGATGG - Intergenic
926973744 2:18492629-18492651 GAAGGAGTCCAGGGAGCTGCTGG - Intergenic
927704184 2:25286844-25286866 GGAGGAGGACATGGAGTTGGGGG - Intronic
928644120 2:33333941-33333963 GGAGGAGTCCAGGGAGTAAGAGG + Intronic
928647103 2:33366111-33366133 GGAGGAGGCCTGGAAGGTGCTGG + Intronic
928813260 2:35254994-35255016 GGAGCAGGACAGAGAGTTGAAGG + Intergenic
928819264 2:35341774-35341796 GAAGGAGGGCAGGGAAGTGCTGG + Intergenic
929424187 2:41827248-41827270 GGAGGAGAGGAGGTAGTTGCAGG - Intergenic
930873813 2:56192343-56192365 GGAGGAGGTGAGGGAGTAGGAGG - Intronic
931696725 2:64876490-64876512 GGAGGAGGCTGGGGAGTGGCAGG - Intergenic
932072173 2:68631672-68631694 TGAAAAGGCCAGGGAGTTGAGGG + Intergenic
932404387 2:71503800-71503822 TGAGAAGGCCAGGGAGGGGCAGG - Intronic
932621786 2:73269133-73269155 CGAGGACGCCACGGACTTGCGGG + Exonic
932735648 2:74252296-74252318 GGAGGAGGCAATGGAGGTGGTGG - Exonic
933666934 2:84971490-84971512 GGCCGAGGCCCGGGAGGTGCGGG - Intronic
934509378 2:94925065-94925087 GGAGGAGGCCAGGGAGTTGTTGG - Intergenic
934564577 2:95331135-95331157 GGGGTAGGCGAGGGAGTGGCAGG + Intronic
935670756 2:105555225-105555247 GGAGAAGGGTAGGGAGTTGTTGG + Intergenic
935717518 2:105952294-105952316 GGAGGAGCCTGGGGAGCTGCTGG - Intergenic
935794826 2:106630888-106630910 GGAGGCTGCCACAGAGTTGCAGG + Intergenic
936307680 2:111356847-111356869 GGCAGAGGCCAGGGCCTTGCAGG - Intergenic
937404227 2:121611997-121612019 GGAGGAGGAGAAGGAGTTACAGG + Intronic
937440204 2:121908725-121908747 GGAGGAGGGAAGAGAGCTGCAGG - Intergenic
938303482 2:130231892-130231914 GGAAGGGGCCAGGGACCTGCAGG - Intergenic
938453197 2:131442364-131442386 GGAAGGGGCCAGGGACCTGCAGG + Intergenic
940404771 2:153287932-153287954 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
942649211 2:178149350-178149372 GGACGAGGCCAGGAGGCTGCTGG + Intergenic
942707975 2:178799097-178799119 GGAGGAGGGCAGGGAAGTGCTGG + Intronic
942715109 2:178882852-178882874 GGTGGAGGGCAGGGAGTTGAGGG + Intronic
942940045 2:181606249-181606271 GGAGGAAGACAGGGAGTGGGGGG + Intronic
943046527 2:182867285-182867307 AGAGAAGGCCTGGGAGTCGCAGG + Intergenic
943182307 2:184560212-184560234 GGAGGAGGCCCTGGAGTGGATGG + Intergenic
945270257 2:207931092-207931114 GAAGCAGGCCAAGGAGTTTCTGG - Exonic
946200413 2:218068083-218068105 GGAGGAGGGCAGGGGGCTGGAGG + Intronic
946200453 2:218068191-218068213 GGAGGAGGGCAGGGGGCTGGAGG + Intronic
946421109 2:219565362-219565384 GGTGGAGGAGAGCGAGTTGCTGG - Exonic
946708027 2:222478201-222478223 GGAGGGGGAGAGGGAGGTGCGGG + Intronic
947288297 2:228542931-228542953 GGAGGAGGCTAGAGAGATCCAGG - Intergenic
947533392 2:230926491-230926513 GGAGGAGGCCAGGAGCCTGCTGG + Intronic
947541190 2:230980920-230980942 GGGGGAGGGGAGGGAGTTGCAGG + Intergenic
947556918 2:231101029-231101051 AGAGCAGGCTAGGGGGTTGCCGG + Intronic
947748148 2:232520017-232520039 GGAGGAGGGCAGGGGGTGTCTGG - Intergenic
948004445 2:234595729-234595751 GTAGGGGGCCAGGGAGTTGGGGG + Intergenic
948205351 2:236160284-236160306 GGTGGAGGCTAGGGTGTTGATGG + Intergenic
948516843 2:238509526-238509548 GGGGGAGGCTTGGGAGGTGCAGG - Intergenic
948903587 2:240967735-240967757 GCAGGAGGCCAGGGTGGGGCAGG - Intronic
948994425 2:241571281-241571303 GGAGCAGGGCAGGAAGTTGGGGG - Intronic
1168895630 20:1321511-1321533 GGAGAGGGCCAGGGAGATGATGG - Intronic
1168948358 20:1779879-1779901 GGAGAAGTCCTGGGAGTTGAAGG + Intergenic
1169358066 20:4924493-4924515 GCAGGAGGCCAGGCAGGAGCTGG - Intronic
1170336818 20:15279312-15279334 GGAGAACACCAGGGATTTGCAGG + Intronic
1170367983 20:15618189-15618211 GGAGGAGGGCAGTGAGTTGTGGG - Intronic
1170556741 20:17520850-17520872 GCAAGAGGCCAGGGAGTTTAGGG - Intronic
1170603377 20:17858902-17858924 GGAGGAGGCCAAGGGGTCTCTGG - Intergenic
1171139575 20:22729282-22729304 GGAGGGTGACAGGGAGGTGCTGG + Intergenic
1171141972 20:22751120-22751142 GGGTGGGGCCAGGGAGTTGAGGG + Intergenic
1171255967 20:23689203-23689225 GGAGGAGGCCTGGGAGGGGCAGG - Intergenic
1171263315 20:23751100-23751122 GGAGGAGGCCTGGGAGGGGCAGG - Intronic
1171272372 20:23826894-23826916 GGAGGAGGCCTGGGAGGGGCAGG - Intergenic
1171406368 20:24914827-24914849 GGTGCAGGGCAGGGAGCTGCTGG - Intergenic
1171428484 20:25063756-25063778 GAAGGACGCCAGGCAGTTGCTGG - Intergenic
1171451239 20:25237528-25237550 GGAGAAGGCCTGGGTGTCGCTGG + Intergenic
1172032892 20:31994170-31994192 GGAACAGGCCAGGGAGCTGCTGG + Intronic
1172251426 20:33482065-33482087 GGAATAGGCCAGGGAGGTGGTGG - Intergenic
1172468617 20:35175037-35175059 GGAGGCGGGCTGGGACTTGCAGG + Intronic
1172612846 20:36264647-36264669 GGAGGAAGCCTGGGGATTGCGGG - Intronic
1172773351 20:37393951-37393973 GGAGGGCGCCACGTAGTTGCTGG - Exonic
1172880238 20:38195106-38195128 GGAGGAGGTTATGGAGATGCTGG + Intergenic
1173162386 20:40662583-40662605 GGAGGAGGGCAGAGAGCAGCCGG - Intergenic
1173489600 20:43469002-43469024 GGAGGAGTTCAAGGAGTTGAAGG + Intergenic
1173563078 20:44020195-44020217 GGATTAGGCCACGGAGTTGCTGG + Intronic
1174366101 20:50057473-50057495 GGTGGAGGACAGGGCGTTCCCGG - Intergenic
1174898196 20:54472707-54472729 GGAAGAGGCCCAGGAGCTGCTGG - Intergenic
1175931016 20:62493730-62493752 GGAAGAGGGCAGGGAGGTGTGGG + Intergenic
1176127095 20:63480471-63480493 GGTGGAGGCCAGGGGGGTGGGGG + Intergenic
1176204168 20:63879135-63879157 AGAGAAGGCCAGGGAGGCGCTGG + Intronic
1176382196 21:6119113-6119135 TGAGGAGGCCAGGCAGGGGCCGG + Exonic
1176605634 21:8828123-8828145 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1176801625 21:13435967-13435989 GGAGGAGGCCAGGGAGTAGCTGG - Intergenic
1177264389 21:18764654-18764676 GGAGGAGGGCAGAGAAGTGCTGG + Intergenic
1177350819 21:19939074-19939096 GGCGGAGGCAGGGGAATTGCTGG - Intergenic
1177513946 21:22123359-22123381 GGAGGAGGGCAGGGAAGTGCTGG + Intergenic
1178019567 21:28393893-28393915 GGAGAAGGCCCTGAAGTTGCTGG + Intergenic
1178384459 21:32138073-32138095 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1178846270 21:36176567-36176589 GGAGGTGGCCAGGTAAGTGCAGG + Intronic
1179117746 21:38509623-38509645 GGAGGAGCCTGGGGAGCTGCTGG - Intronic
1179292640 21:40031984-40032006 GTAGGAGGCCAGAAAGTTGAAGG - Intronic
1179304502 21:40142078-40142100 GGAGGGGGCCAGGAAGTTCAGGG - Intronic
1179358258 21:40682177-40682199 GGAGGTGGCCAGAGGGATGCGGG + Intronic
1179409865 21:41154194-41154216 GGTGGAGGCCAGAGACCTGCTGG + Intergenic
1179543685 21:42100716-42100738 TGAGGAGGGCACGGGGTTGCTGG - Intronic
1179543699 21:42100750-42100772 TGAGGAGGGCATGGGGTTGCTGG - Intronic
1179543727 21:42100818-42100840 TGAGGAGGGCACGGGGTTGCTGG - Intronic
1179741276 21:43419126-43419148 TGAGGAGGCCAGGCAGGGGCCGG - Exonic
1180054914 21:45352736-45352758 GGAGGAGGCCGAGGAGGGGCTGG - Intergenic
1180058841 21:45374530-45374552 GGAGGAGGCAGGGGAGGGGCAGG - Intergenic
1180347931 22:11719727-11719749 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1180355709 22:11837829-11837851 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1180382544 22:12154496-12154518 GAAGGAGGCCAGGGAGTTGTTGG - Intergenic
1180972573 22:19823024-19823046 GCAGGAGGCCTGGGAGGGGCCGG + Intronic
1181004820 22:20008267-20008289 GGAGGAGGCCAGGCTGGTGCTGG + Intronic
1181044072 22:20206414-20206436 ACAGGAGGCCAGGGACTGGCTGG + Intergenic
1181059694 22:20276450-20276472 GTGGGAGGCCTGGGACTTGCTGG - Intronic
1181546568 22:23605682-23605704 GGGGGAGGCCAGTGAGATGCTGG + Intergenic
1181796132 22:25312370-25312392 CAAGGAGGCCAGGGGGCTGCAGG + Intergenic
1181836678 22:25615980-25616002 CAAGGAGGCCAGGGGGCTGCAGG + Intronic
1182299347 22:29329165-29329187 GGAGGCTGCCAGGGAGTGCCCGG + Intronic
1182412142 22:30196337-30196359 GGAGGAAGCCAGTGGGTTGGAGG - Intergenic
1182549009 22:31091132-31091154 GGAGGAGGCAGGGGTGGTGCTGG - Exonic
1182557672 22:31137909-31137931 GGAGGTGGCCCGGGAGCTCCAGG + Exonic
1182720974 22:32399731-32399753 GGAGGAGGCCTTGGAGATGGGGG - Exonic
1183051493 22:35265513-35265535 TGTGGAGGCCAGGAAGTGGCAGG - Exonic
1183107047 22:35622342-35622364 GGCTGAGGCCTGGGAGTTGCAGG + Intronic
1183134437 22:35872940-35872962 GGAGGGGGTCAGGGAAGTGCTGG - Intronic
1183357329 22:37366750-37366772 GAAGGAGGCCTGGGACTGGCAGG + Intergenic
1183456861 22:37927612-37927634 AGAGGAGGCCAGGGAGGAGTTGG - Exonic
1183471501 22:38009394-38009416 GGCGGGGGCCAGGGAGCTGGGGG + Intronic
1183584235 22:38742865-38742887 GGAGGAGGACTGGAAGCTGCAGG + Intronic
1183645479 22:39123866-39123888 AGAGGAGGACAGGGAGGTCCTGG + Intronic
1184225216 22:43125788-43125810 TGAGGAGGCCATGCAGTTCCTGG + Intronic
1184479174 22:44737087-44737109 GGAGCGGGGCAGGGAGCTGCGGG - Exonic
1184487955 22:44792507-44792529 GCAGGAGGGCAGGGGGTTCCTGG - Intronic
1184804163 22:46781694-46781716 GGGGCAGGCCAGGGAGGGGCCGG - Intronic
1185041976 22:48508949-48508971 GGAGGAGGCTAGGGAGAGGTTGG - Intronic
1185077715 22:48692097-48692119 GGAGGAGGCTAGGGTCTTCCTGG + Intronic
1185345380 22:50308376-50308398 GCTGGAGGCCAGGGATGTGCTGG - Intergenic
1185418353 22:50721715-50721737 TGAGGAGACCAGGGAGGAGCTGG + Intergenic
949617579 3:5770667-5770689 AGAGGAGGGCAGGGAAGTGCTGG - Intergenic
949778051 3:7653951-7653973 GAAGGGGGCAAGGGAGTAGCAGG - Intronic
950122377 3:10490134-10490156 GGAGGAAGCCAGGGGGATGCAGG - Intronic
950144067 3:10635388-10635410 GGAGGAGGGAAGGGAAATGCAGG - Intronic
950621887 3:14212636-14212658 GCAGGAGGCAAGAGAGTGGCAGG + Intergenic
952003055 3:28808961-28808983 GGAGAAGGGCAGGGAAGTGCTGG - Intergenic
952254320 3:31682381-31682403 GGTGGAGGTCAGGGAGGTGATGG - Intronic
952710706 3:36429449-36429471 GGAGGAGACCTGGGAGTGGTGGG + Intronic
952751864 3:36831317-36831339 GGAGGAGGCCAGGGAGCCCAGGG - Exonic
953496673 3:43393585-43393607 AGAGTTGGCCAGGGATTTGCAGG - Intronic
953655015 3:44844169-44844191 GGACAGGGCCAGGGAGCTGCAGG - Intronic
953905419 3:46866090-46866112 GAAGGTGGGCAGGGAGTTGGGGG + Intronic
954198044 3:49007830-49007852 GGCGGAGGCCCGGGAGCTGAGGG + Intronic
954263997 3:49459489-49459511 GGAGGAGGCCTGGCAGCAGCAGG + Intergenic
954453249 3:50583012-50583034 GGAGGAGGACATGGAGCTGATGG + Exonic
954458045 3:50610681-50610703 GGAAGAGGACATGGAGGTGCTGG - Intronic
955027059 3:55178385-55178407 GGAGGTGGCCAGCGAGTTGGTGG - Intergenic
955379400 3:58424793-58424815 GCAGGAGGCAAGGGAGCTGCTGG - Exonic
955751334 3:62187815-62187837 GCATGAGGCCAGGGCTTTGCAGG - Intronic
956216792 3:66857832-66857854 GGAAGGGGGCAGGGAGGTGCTGG + Intergenic
956220777 3:66900443-66900465 GGAGGAGGCTAGGGAGAGGTTGG - Intergenic
958002018 3:87762208-87762230 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
960515297 3:118596164-118596186 GGAGGGGGACAGGGAAGTGCTGG - Intergenic
960953008 3:123011766-123011788 GGAGGAGGCCATGGCAATGCTGG + Intronic
961121250 3:124373086-124373108 GGAGGAGGTTAGGGGGTTGAGGG - Intronic
961471237 3:127114503-127114525 GGAGGATGACAGGGAGAAGCAGG - Intergenic
961475809 3:127145594-127145616 GGAGGAGGACAGGGAGAGGAAGG - Intergenic
961547396 3:127644803-127644825 GCAGAAGGCTAGGGAGGTGCAGG + Intronic
961547414 3:127644863-127644885 CCAGGAGGCCAGGCAGGTGCAGG + Intronic
961662973 3:128480189-128480211 GTAGGAGGCGAGGGGGTTGAAGG + Exonic
961673191 3:128549496-128549518 GGAAGAGGCTGGGGAGTTTCTGG + Intergenic
961924664 3:130465175-130465197 GGAGGAGCCCAGTGAGCTCCTGG + Intronic
962283972 3:134071553-134071575 GCAGGAGGGCAGGGCCTTGCAGG - Intronic
962419942 3:135219003-135219025 GGAGGAGAGGAGGGAGTTGGAGG + Intronic
962801362 3:138893574-138893596 GGAGGAGGCCTTGTATTTGCAGG + Intergenic
962814054 3:138982772-138982794 GGAGAAGCCCAGGGCGTGGCCGG + Intergenic
962850957 3:139308007-139308029 CAAGGAGGCCAGGGAGATGCTGG - Intronic
963733062 3:148991396-148991418 GGAGGAGCCGAGGGAGACGCGGG + Exonic
965384501 3:168029928-168029950 GGAGGAGGCCCAGCAGCTGCGGG - Exonic
967258973 3:187623278-187623300 GGAAGCGGACAGGGAGTTTCAGG - Intergenic
968311094 3:197683549-197683571 TGAGCAGGCCAGGGTGCTGCGGG - Intronic
968368219 3:198203691-198203713 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
968653000 4:1767410-1767432 GGAGGAGGGGAGGGAGGGGCAGG - Intergenic
968924603 4:3540517-3540539 AGAGCAGGCCAGGGTTTTGCAGG - Intergenic
969108838 4:4828750-4828772 GGAGGAGGAGAGGGAGAAGCAGG - Intergenic
969271413 4:6105841-6105863 GGAGAAGACCAAGGAGCTGCAGG - Exonic
969517164 4:7654289-7654311 AGAGGAGGAAAGGGAGCTGCAGG - Intronic
969608056 4:8212047-8212069 GGTGGAGCCCATGGGGTTGCTGG + Intronic
969629646 4:8328866-8328888 GGAGGAGGCCAGGAGGAGGCTGG + Intergenic
969685660 4:8672612-8672634 GTCGGAGGCCAGGGAGTCTCAGG + Intergenic
969940343 4:10725428-10725450 GGAGGAGGCTAGGGAGGGGTGGG - Intergenic
970574309 4:17412403-17412425 GGAGGGGGGCAGGGAAATGCAGG - Intergenic
970959560 4:21856721-21856743 GGAAGAGGCCAGGCAGTGGAAGG - Intronic
971831434 4:31701267-31701289 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
973372476 4:49262866-49262888 GAAGGAGGCCAGGGAGTTGTTGG - Intergenic
973388527 4:49532275-49532297 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
974121072 4:57640010-57640032 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
974655277 4:64811139-64811161 GGAGGAGGCCAGGAAGGTTAAGG + Intergenic
974711875 4:65608039-65608061 GGATGAAGCCAGGGAGTGGGCGG + Intronic
974860914 4:67520489-67520511 GGTGGAGGACAGGGGGTTGCTGG - Intronic
978126969 4:105146626-105146648 GGAGGAGGCCGGGGCGGAGCAGG + Exonic
978402941 4:108349956-108349978 GGCGGAGGCCAGGCAGTGACTGG - Intergenic
979256647 4:118613419-118613441 CAAGGAGGCCAGGGAGTTGCTGG + Intergenic
979258151 4:118625458-118625480 GGAGGGAGCCAGGGAGTTGCTGG + Intergenic
979258208 4:118625761-118625783 GGAGGAGGCCAGGGAGTTGCTGG + Intergenic
979275671 4:118812284-118812306 GGAGGCGGGCAGGGAAGTGCTGG + Intronic
979330141 4:119414807-119414829 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
979330196 4:119415110-119415132 GGAGGGAGCCAGGGAGTTGCTGG - Intergenic
979331701 4:119427126-119427148 CAAGGAGGCCAGGGAGTTGCTGG - Intergenic
980286294 4:130782726-130782748 GAAGGGGGACAGGGAGGTGCTGG + Intergenic
981012075 4:139935490-139935512 GAAGGAGGGCAGGGAGTTGAGGG - Intronic
981196541 4:141927581-141927603 TGAGGTGGACAGCGAGTTGCTGG + Intergenic
982202983 4:152976398-152976420 GGAGGAGGCCACTGTGTTCCGGG - Exonic
983588685 4:169383446-169383468 GGAGGAGGGCAGGGAAGTGCTGG - Intergenic
983865475 4:172760617-172760639 GGAGGTGGCTAGGAAGTTGCAGG - Intronic
984289942 4:177782119-177782141 GGAGGGGGGCAGGGAAGTGCTGG - Intronic
985223384 4:187732031-187732053 GGAGGAGGACGGGGAGGGGCTGG - Intergenic
986231032 5:5864929-5864951 GGAGGAGGGCAGGGAAGTACTGG - Intergenic
986543457 5:8870774-8870796 GGAGGGGGCCGGGGAAGTGCTGG - Intergenic
986829651 5:11561630-11561652 GGAGGATGCTAGGAATTTGCGGG - Intronic
986971861 5:13346207-13346229 AGAGGAGGGCAGGGAGTGGGTGG + Intergenic
987397915 5:17443220-17443242 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
988599210 5:32623893-32623915 TGAGGTGGCCAGGGAGCTGCAGG + Intergenic
989275694 5:39586138-39586160 GGAGGGGGACAGGGAACTGCTGG + Intergenic
989523180 5:42424231-42424253 TGAGGGCGGCAGGGAGTTGCGGG + Intronic
990951843 5:61305995-61306017 GAAGGATAACAGGGAGTTGCAGG + Intergenic
991115183 5:62946647-62946669 GGAAGAGGGCAGGGAAGTGCTGG + Intergenic
991483201 5:67105951-67105973 GGAGGATGTCAGTGAGTTGAGGG - Intronic
992210888 5:74478513-74478535 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
992488184 5:77215831-77215853 GGAGGGGGCCAGGGAGCAGGTGG + Intronic
992869602 5:80993183-80993205 GGAGGCAGCCAGGGAGGTGCAGG - Intronic
993168189 5:84383856-84383878 GGAAGAGGCTGGGGAGCTGCAGG - Intronic
993371332 5:87096521-87096543 TAAGGAGGCAAGGGAGTTGAGGG - Intergenic
993412728 5:87593016-87593038 GGATGAGTCCAGGGACCTGCTGG + Intergenic
994661580 5:102660865-102660887 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
996738320 5:126777102-126777124 GGAGGAGGGCCGGGAGGGGCGGG - Intronic
997303476 5:132823065-132823087 GGAGGACGCCAAGGAGCTGAAGG - Exonic
997423813 5:133789172-133789194 GGAGGTGGCCAGGGTGGTGGGGG + Intergenic
997469863 5:134111398-134111420 GGAGGTGACCGGGGAGTTTCAGG - Intergenic
997847787 5:137303842-137303864 GGAGAAGGGCAAAGAGTTGCTGG - Intronic
998166189 5:139845524-139845546 GGGAGGGGCCAGTGAGTTGCAGG + Intergenic
999145706 5:149391900-149391922 GGAGGAGGCCTGGGAACTGTAGG - Intronic
999189108 5:149733062-149733084 GGGGGAGGAGAGGGGGTTGCAGG - Intronic
999439894 5:151593090-151593112 TGAGAGGCCCAGGGAGTTGCAGG + Intergenic
999609202 5:153351066-153351088 GCAGGAGGCCAGAGAGGTGCTGG - Intergenic
1000171644 5:158708142-158708164 GGAGGAGGCCATGGTGGGGCTGG + Exonic
1001185502 5:169567675-169567697 GGAGGAGGAGAGGGAGTGGGAGG - Intergenic
1001542776 5:172551027-172551049 GGAGGAAGCCAGCAAGTTGATGG - Intergenic
1002435497 5:179228560-179228582 GCAGGAGGCAAGGCAGTGGCCGG - Intronic
1002662022 5:180797716-180797738 GGTGGAGGCCAGGGCTTGGCCGG - Intronic
1002727440 5:181308922-181308944 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1002839509 6:893865-893887 GGAGGAGGCCAGGGCTGGGCAGG - Intergenic
1002839846 6:896287-896309 GGAGCAGGGCGGGGGGTTGCGGG - Intergenic
1002960533 6:1910601-1910623 GTAGGAGGCCAGGCAGCAGCAGG + Intronic
1003324637 6:5083147-5083169 GAAGGAGGTGAGGGAGGTGCTGG - Intergenic
1003415097 6:5899996-5900018 AGTGGAGGCCAGAGAGCTGCTGG - Intergenic
1003733718 6:8854312-8854334 AGAGGAGCCCTGGGAGTTGGAGG + Intergenic
1003856845 6:10285019-10285041 GAAGGAGACCAGGGAGCTGCTGG + Intergenic
1004114127 6:12749857-12749879 GGAGGACGCCCGGGAGGGGCGGG - Intronic
1004306789 6:14508541-14508563 GGTGGAGGCCAGTGGGTTGAGGG - Intergenic
1004757204 6:18624215-18624237 GGAAGAGGTTGGGGAGTTGCAGG + Intergenic
1004906242 6:20239297-20239319 GCAGGAGCCCACGGAGTGGCGGG - Intergenic
1005332280 6:24761580-24761602 GGAGGAGGCCAGGAAGAGGCAGG - Intergenic
1006024363 6:31138018-31138040 GCAGGAGGCCAGGGGTTTTCTGG + Exonic
1006025889 6:31146497-31146519 GGAGGAGGCCAAGGAGTGTCTGG + Intronic
1006406719 6:33849830-33849852 GCAGGAGGCCTGGAAGGTGCCGG - Intergenic
1006588176 6:35132799-35132821 GGTGGTGGTGAGGGAGTTGCAGG - Intronic
1006641054 6:35490149-35490171 GGAGGCGGGCAGGGACTTGGGGG - Intronic
1006839351 6:37018476-37018498 GGAGGAGGCCAGGGAGTCATAGG - Intronic
1006839973 6:37022423-37022445 GGTGGAGGCCTGGGTGATGCAGG - Intronic
1006945703 6:37783326-37783348 GGAGGAGGCCTGGGGATGGCAGG + Intergenic
1007169402 6:39852102-39852124 TGTGGAGGGCAGGGAGCTGCTGG + Intronic
1007450764 6:41939447-41939469 GGAGGAGGCGGGGGAGCTGCTGG - Intronic
1007628579 6:43260093-43260115 GGAGGGGGCCTGGGAATTGCTGG + Intronic
1007722169 6:43891536-43891558 GCAGGAGGCCAGTCAGGTGCGGG + Intergenic
1008727740 6:54442112-54442134 GAAGCAGGGCAGGGAGGTGCTGG - Intergenic
1011147979 6:84239792-84239814 GGTGGTGGCCAGGGACTTGGGGG + Intergenic
1011410175 6:87059626-87059648 GGGGGAGGCCAGGGAGGTGGGGG + Intergenic
1012268622 6:97179647-97179669 CAATGAGGCCAAGGAGTTGCAGG - Intronic
1012913209 6:105139778-105139800 GGAGGAGACCAGGGAGCTTAAGG - Intergenic
1013627575 6:111952859-111952881 GGAGGATGCCAGGGAGAGGTAGG - Intergenic
1013667412 6:112362574-112362596 GGAGCAGGACACGGAGTTCCCGG + Intergenic
1013722559 6:113048482-113048504 AGAGGTGGCCAGAGAGATGCAGG - Intergenic
1014620508 6:123661212-123661234 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1014867630 6:126551253-126551275 GGAGCAGGGCAGGGAGGTGCTGG - Intergenic
1015168391 6:130224406-130224428 GGAGGCGGGCAGGGAAGTGCTGG - Intronic
1015540544 6:134309368-134309390 GGAGGAGGTGAAGGAGGTGCAGG - Intronic
1015717418 6:136206717-136206739 GGAGGAGGTTAGGGAGGTGGTGG + Intergenic
1015729534 6:136334335-136334357 GAAGGCGGGCAGGGAGGTGCTGG + Intergenic
1017869924 6:158478646-158478668 ACAGGAGGCCAGGCAGTTGCAGG - Intronic
1017946474 6:159100328-159100350 GGAGGGGGACAGAGAGTTGAGGG - Intergenic
1018101720 6:160446252-160446274 GGAGGAGGGCAGGCAGAGGCAGG + Intronic
1018346025 6:162899981-162900003 GGGGAAGGTCAGGGAGCTGCAGG + Intronic
1018650520 6:165988310-165988332 GGAGGGGCCCGGGGAGGTGCTGG + Intergenic
1018723277 6:166590023-166590045 GGAGGAGGCAAGGGAACTGGGGG + Intronic
1018774360 6:166999442-166999464 CGAGGAGGACACGGAGCTGCGGG + Exonic
1019127547 6:169850951-169850973 GGAGGAGGCCGGAGAGCCGCCGG + Intergenic
1019441406 7:1049282-1049304 GGAGGAGGCCAAAGATCTGCAGG + Intronic
1019723237 7:2586396-2586418 GAGGGAGGCCAGGGAATGGCAGG + Intronic
1020013179 7:4817289-4817311 CGAGGAGGCCATGGCGGTGCTGG - Exonic
1020096174 7:5370810-5370832 GGTGGAGGCCAAGGAGGAGCCGG - Exonic
1020469246 7:8517212-8517234 GGGGAAGGACAGGGTGTTGCGGG + Intronic
1020552243 7:9621561-9621583 ACAGGAGCCCACGGAGTTGCGGG + Intergenic
1021009328 7:15442623-15442645 GGAGGAGGGCAGGGAAGTGCTGG + Intronic
1021174434 7:17434774-17434796 GGAAAAGGCCATGGAGTTGCTGG + Intergenic
1021890851 7:25184969-25184991 GGAGGAGGCGATGAAGATGCTGG - Intergenic
1022142948 7:27509088-27509110 GGAGGAGGCCAAGGACTGGCAGG - Intergenic
1022359338 7:29643591-29643613 GGAGGAGCCGAGGGAGCTGAGGG + Intergenic
1022396278 7:29989953-29989975 GGAGGGGGCCTGGGAGCTGGAGG + Intronic
1022992690 7:35724539-35724561 GGAGGTGGCCAGGGAAGTGCTGG + Intergenic
1023398622 7:39774710-39774732 CAAGGAGGCCAGGGAGTTGCTGG + Intergenic
1023400136 7:39786751-39786773 GGAGGGGGCCAGGGAGTTGCTGG + Intergenic
1023400193 7:39787055-39787077 GGAGGAGGCCAGGGAGTTACTGG + Intergenic
1023513308 7:40976186-40976208 GGAGGAGGTGAGTGCGTTGCAGG + Intergenic
1024002907 7:45202697-45202719 GGAGGAGGCCTGGGGCCTGCAGG - Intergenic
1024073065 7:45802502-45802524 GAAGGGGGCCAGGGAATTGCTGG + Intergenic
1024073121 7:45802806-45802828 GGAGGAGGCCAGGGAGTTACTGG + Intergenic
1024192390 7:47025835-47025857 GGCTGAGACCAGGGAGATGCTGG - Intergenic
1024203148 7:47126438-47126460 GGAGGACGGCAGGGAAGTGCTGG - Intergenic
1024516366 7:50262379-50262401 GTTGGATGGCAGGGAGTTGCAGG + Intergenic
1024650210 7:51397382-51397404 GGAGGAGGCCAGGGAGTTACTGG - Intergenic
1024650268 7:51397686-51397708 GGAGGGGGCCAGGGAGTTGCTGG - Intergenic
1024651815 7:51409995-51410017 TGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1025054357 7:55753031-55753053 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1025054412 7:55753336-55753358 GGAGGGGGCCAGGGAGTTGCTGG - Intergenic
1025132407 7:56383184-56383206 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1025132464 7:56383488-56383510 GGAGGGGGCCAGGGAGTTGCTGG - Intergenic
1025134025 7:56395776-56395798 TGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1025183467 7:56837638-56837660 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1025185613 7:56855997-56856019 GGGAGGAGCCAGGGAGTTGCTGG - Intergenic
1025686316 7:63720953-63720975 GGGAGGAGCCAGGGAGTTGCTGG + Intergenic
1025688458 7:63739329-63739351 GGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1025910000 7:65820594-65820616 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1025911526 7:65832540-65832562 GCAGGAGGCCAGGGAGTTGCTGG + Intergenic
1025911571 7:65832824-65832846 AGAGGAGGCCAGGGAGTCGGTGG + Intergenic
1025978078 7:66385452-66385474 GGAGGAGGCCAGGGAGTTGCTGG - Intronic
1025978128 7:66385736-66385758 GCAGTAGGCCAGAGATTTGCTGG - Intronic
1025998190 7:66541761-66541783 GGACCAGGCCAGGGACCTGCAGG + Intergenic
1026054177 7:66970491-66970513 GGAGGAGGGCAGGGAAGTGCTGG + Intergenic
1026111116 7:67459587-67459609 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1026176067 7:67998077-67998099 GAAGGAGGCCATGGACTGGCAGG + Intergenic
1026671803 7:72397279-72397301 GGAGGATGCCAGAGAGAGGCAGG + Intronic
1026827969 7:73595873-73595895 GGAGGAGGCCCAGCAGCTGCGGG - Exonic
1026952438 7:74356571-74356593 GGAGGAGGCCACAGAGCTGACGG - Exonic
1026991144 7:74586557-74586579 GGACCAGGCCAGGGACCTGCAGG + Intronic
1027203659 7:76080116-76080138 GGAGGAGGCCAGGGAGTTGCTGG - Intergenic
1027203707 7:76080400-76080422 GCAGCAGGCCAGAGATTTGCTGG - Intergenic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1028689641 7:93637208-93637230 GGAGAAGACCAGGAAGTAGCTGG + Intronic
1029272236 7:99384174-99384196 GGAGGAGGCTAGGGACAGGCTGG + Intronic
1029350459 7:100009723-100009745 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029350476 7:100009784-100009806 GAAGGTGGCCAGGGAGGGGCAGG + Intergenic
1029368592 7:100132825-100132847 GCTGGAGACCAGGGAGTTGGAGG - Intergenic
1029814262 7:103076985-103077007 GGAGGAGCCCAGGGAAGTGGAGG - Intronic
1029910151 7:104137395-104137417 GGAGGGGGGCAGGGAAGTGCTGG + Intronic
1029978686 7:104858194-104858216 TGAGGAGGCCAGCAAGTTGTAGG - Intronic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1030414446 7:109224206-109224228 GGAGTAGGGAAGGGAGTAGCGGG + Intergenic
1030629798 7:111883419-111883441 GGAGGAGGCCTGGAAATAGCAGG - Intronic
1030740678 7:113105619-113105641 GGAGGATGAGAGGGAGTTGAGGG + Intergenic
1030746496 7:113172628-113172650 GGAGGGGGGCAGGGAAATGCTGG + Intergenic
1031149972 7:118042194-118042216 GGTTGAGGCCAGAGAGTTGATGG - Intergenic
1031689101 7:124765945-124765967 GGAGGAGGCGAAGGAGTGGGAGG - Intergenic
1031922920 7:127614549-127614571 GGAGGAGACCTGGGAGTGTCAGG + Exonic
1031979569 7:128116000-128116022 GCAGGAGTCCAGGGAGCTGGGGG - Intergenic
1032048959 7:128634185-128634207 TGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1032050451 7:128646196-128646218 GGAGGGGGCCAGGGAGTTGCTGG + Intergenic
1032050508 7:128646500-128646522 GGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1032079445 7:128851354-128851376 GGAGAAGGTGAGGGAGCTGCAGG + Exonic
1032089455 7:128904004-128904026 GCAGGTGTCCAGGGAGGTGCAGG + Intronic
1032386542 7:131529503-131529525 GAAGGAGGCCAGGGAGGAGGTGG + Intronic
1032673395 7:134106519-134106541 GGAGGAGGGCAGGGAAGTGCTGG - Intergenic
1032854753 7:135825107-135825129 GGAGGAGGGAAGGCAGTTGTGGG - Intergenic
1032895754 7:136248934-136248956 GCAGGAGGCCAGGCAGTGCCTGG + Intergenic
1033970681 7:147035013-147035035 GGAGGAGGGCAGAGAAGTGCTGG - Intronic
1034010054 7:147519762-147519784 GGATGAGGCAGGAGAGTTGCTGG + Intronic
1034285686 7:149881763-149881785 GGAGGATGCCGGGAGGTTGCAGG + Intergenic
1034345560 7:150383496-150383518 GCAGGAGGGCAGGGAGGCGCTGG + Intronic
1034392786 7:150799984-150800006 GGACGGGGCCAGGGAGCGGCGGG - Intronic
1034594988 7:152181351-152181373 GTAGTAGGCCGGGGAGTTCCAGG + Exonic
1034678440 7:152909804-152909826 GGCGGAGGCCAGGGACCTGCTGG + Intergenic
1034931217 7:155165620-155165642 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1034971675 7:155423410-155423432 GGTGGAGGCGAGGGAGTGGGAGG + Intergenic
1034997892 7:155589909-155589931 AGAGGAGGGAGGGGAGTTGCAGG - Intergenic
1035286023 7:157807737-157807759 GCAGGAGGCCAGGCATTTGCAGG - Intronic
1035315950 7:157997697-157997719 GGAGGAGTGCAGGGAGGGGCAGG + Intronic
1035361893 7:158318709-158318731 GCAAGAGGCCGGGGAGCTGCAGG - Intronic
1035375589 7:158404863-158404885 GCTGGAGGCCAGGGAGCTGGGGG - Intronic
1035375659 7:158405052-158405074 GCTGGAGGCCAGGGAGCTGGGGG - Intronic
1035392763 7:158516440-158516462 GGAGGGGGCTGGGGAGTTGAGGG - Intronic
1035751212 8:1997689-1997711 GGTGGTGGACAGGGAGCTGCTGG + Intronic
1036242214 8:7090776-7090798 AGAGGAGGCCAGGGAGTAAGGGG - Intergenic
1036772331 8:11587853-11587875 AGAGAAGGCCAGGGAGTGGCGGG - Intergenic
1036773232 8:11592857-11592879 GGAGGCGGGCAGGGAGTAGAAGG + Intergenic
1037175830 8:15945076-15945098 GGAGGAGGGCAAGGAAGTGCTGG + Intergenic
1037635771 8:20700186-20700208 GGTGGAGGGGAGGGAGTTTCCGG + Intergenic
1037906729 8:22719782-22719804 GGGGAAGGCCAGGGAGGGGCAGG + Intronic
1038682420 8:29681311-29681333 GGAGAAGGCCAGGTGGTTGGGGG - Intergenic
1039607963 8:38898609-38898631 GGAGGAGGCCAGGAACATGTTGG - Intergenic
1039749711 8:40466153-40466175 GAAGGAGGCCTGGGAGTATCTGG - Intergenic
1039787988 8:40850299-40850321 GAAGGAGGGCAGTGAGTGGCGGG - Intronic
1040110072 8:43563326-43563348 GGAGGAAGCCAGGGACTTCCCGG + Intergenic
1040522890 8:48193152-48193174 GGAGGAGGACAGGGAGGAGAAGG + Intergenic
1040532037 8:48274092-48274114 GGAGGAGGGCAGGGAGCCCCTGG + Intergenic
1042576366 8:70224914-70224936 GCAGGAGGACAGGGAGGAGCGGG - Intronic
1042864910 8:73348700-73348722 AGAGGAGGACAGGGGGTAGCCGG + Intergenic
1042930998 8:74014045-74014067 GACGGCGGCCAGGGAGTAGCAGG + Intronic
1042949775 8:74189119-74189141 GGAGGAGGACAGGGAGGAGAAGG - Intergenic
1043599741 8:81923233-81923255 GGAGGGGGGCAGGGAAGTGCTGG + Intergenic
1043982457 8:86657926-86657948 GGGGGAGGCCAGGGCATGGCAGG - Intronic
1044524028 8:93231144-93231166 AGAGAAGGCCAGGGACTGGCTGG + Intergenic
1044829010 8:96227319-96227341 GAAGGAGGGGAGGGAGTTGGTGG + Intronic
1047247447 8:123157776-123157798 GGAGGAGTCCGGGGACTGGCGGG - Intergenic
1047247618 8:123158802-123158824 GGAGAAGGACTGGGAGCTGCCGG + Intergenic
1047835844 8:128689515-128689537 GGAGGCGGGCAGGGAAATGCTGG - Intergenic
1048261193 8:132946619-132946641 GGAGGAGGCTAGAGACTTGTTGG - Intronic
1048314462 8:133351842-133351864 GGAGGAGGCCAGTGTGTAGCTGG + Intergenic
1048566318 8:135601469-135601491 AGAGCAGGCCAGAGACTTGCAGG + Intronic
1048823076 8:138397670-138397692 TGTGGAGCCCAGGGAGTGGCAGG - Intronic
1048896028 8:138993102-138993124 GGCTGAGGCCAGAGAATTGCTGG + Intergenic
1049348503 8:142151853-142151875 CCAGCAGGCCAGGGGGTTGCTGG - Intergenic
1049427424 8:142543672-142543694 GGAGAAGGACAAGGAGGTGCTGG + Exonic
1049448202 8:142641317-142641339 GGAGGTGTCCAGGGCTTTGCAGG - Intergenic
1049461031 8:142727917-142727939 GGAGGGGGCCAGGGACTAGGAGG - Intronic
1049746427 8:144265140-144265162 GGAGCAGGTGAGGGGGTTGCAGG + Intronic
1051727310 9:20101623-20101645 CAAGGAGGCCAAGGAGTTTCCGG + Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1052514533 9:29462893-29462915 GGTGGAGGCAAGGCAGTTGGGGG - Intergenic
1052690478 9:31809702-31809724 GGAGGAGGGCAGGGAAGTGCTGG - Intergenic
1052743957 9:32421490-32421512 GTATGGGGCCAGGCAGTTGCAGG - Intronic
1053185479 9:36012775-36012797 GGAGGGAGCCAGGGAGAGGCTGG - Intergenic
1053656055 9:40219200-40219222 GGAGGAGGCCAGGGAGTTGTGGG + Intergenic
1053799686 9:41756548-41756570 AGAGCAGGCCAGGGTTTTGCAGG - Intergenic
1053906401 9:42848402-42848424 GGAGGAGGCCAGGGAGTTGTGGG + Intergenic
1054145534 9:61558450-61558472 AGAGCAGGCCAGGGTTTTGCAGG + Intergenic
1054188095 9:61968603-61968625 AGAGCAGGCCAGGGTTTTGCAGG - Intergenic
1054352419 9:64029229-64029251 GAAGAAGGCCAGGGAGTTGTTGG + Intergenic
1054368161 9:64365424-64365446 GGAGGAGGCCAGGGAGTTGTGGG + Intergenic
1054428697 9:65142726-65142748 GGTGGAGGACAGGGGGTTGGAGG + Intergenic
1054465274 9:65489558-65489580 AGAGCAGGCCAGGGTTTTGCAGG + Intergenic
1054528559 9:66157095-66157117 GGAGGAGGCCAGGGAGTTGTGGG - Intergenic
1054650421 9:67619973-67619995 AGAGCAGGCCAGGGTTTTGCAGG + Intergenic
1054675781 9:67855167-67855189 GGAGGAGGCCAGGGAGTTGTGGG + Intergenic
1054839935 9:69727301-69727323 GGTGGGGAACAGGGAGTTGCTGG - Intronic
1055443834 9:76363246-76363268 GGAGGGGGCCAGGAAATTGAGGG - Intergenic
1055508304 9:76970518-76970540 GGAGGAGGCCGAGGAGAGGCTGG - Intergenic
1055626061 9:78178653-78178675 GGGGGGGGCCAGTGAGTAGCAGG - Intergenic
1055785222 9:79863772-79863794 GAAGGCGGCCAGGAAGGTGCTGG + Intergenic
1055796805 9:79983302-79983324 GCAGGAGCCCAGGGGGTAGCAGG + Intergenic
1055912997 9:81373071-81373093 GGAGGAGGAGAGAGAGTTGGAGG - Intergenic
1055975344 9:81949682-81949704 GGAGGGAGCCATGTAGTTGCAGG - Intergenic
1056377387 9:86028071-86028093 GGAGGGGGACAGGGAAGTGCTGG + Intronic
1056948968 9:91026645-91026667 GGTGGGGGCTAGGGAGTTGGAGG + Intergenic
1057226167 9:93294414-93294436 GGTGGAGGCCAGAGAGTGGATGG + Intronic
1057372987 9:94490775-94490797 GTAGGATGCCAGGGAGTTGTTGG + Intergenic
1057501545 9:95600717-95600739 GGAGGAGACCAGGGAGTGAGGGG - Intergenic
1057881365 9:98795440-98795462 GGCAGATGCCAGGGAGTTGGGGG - Intronic
1058464852 9:105217063-105217085 GGGGGAGGGCAGGGAGATGGGGG - Intergenic
1060401847 9:123354124-123354146 GGAGGAAGCCAGGGAGTCGCTGG - Intergenic
1060813353 9:126622427-126622449 TGAGGAGGCCACCGAGCTGCTGG + Intronic
1060960736 9:127678904-127678926 GGAGGAGGGCAGGGCGGGGCAGG - Intronic
1061135056 9:128729131-128729153 GGAGGGGACCAGGAAGTCGCTGG - Intergenic
1061232002 9:129320671-129320693 GGAGGAGGCCGGGGCGCTGTGGG - Intergenic
1061847426 9:133395483-133395505 GGAGGAGACCAGGGAGAGCCAGG - Intronic
1061893117 9:133633256-133633278 GGGGTAGGCCGGGGAGGTGCAGG - Intergenic
1061955178 9:133957556-133957578 AGGGGAGGCCAGGGACATGCGGG + Intronic
1062079921 9:134618400-134618422 GGAGGAAGCCAAGGAGGTTCCGG - Intergenic
1062116637 9:134813014-134813036 GGAGGAGGCAGGGGCTTTGCTGG - Intronic
1062322084 9:135995065-135995087 GGTGGCGGCCAGGGAGGTGTGGG - Intergenic
1062337600 9:136079244-136079266 GGGGGAGACCAGGGAGAGGCAGG + Intronic
1062453515 9:136625300-136625322 GGAGGCTGCCAGAGAGTGGCTGG - Intergenic
1062469672 9:136696944-136696966 GAAGGAGGCCAGGGAGGAGGGGG - Intergenic
1062613190 9:137384042-137384064 GTCGGAGGCCAGGGAGGGGCAGG + Intronic
1062752560 9:138266396-138266418 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1203553027 Un_KI270743v1:180131-180153 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1203575074 Un_KI270745v1:1171-1193 CGAGGAGGCCAGGGAGTTGCTGG + Intergenic
1185778867 X:2829017-2829039 GGAGGAGGCCTGGGCGCGGCGGG + Intronic
1187138443 X:16570753-16570775 GTAGGAGGACAGGGAAGTGCTGG + Intergenic
1187722318 X:22164016-22164038 GGAGAATGCCTGGAAGTTGCTGG + Intronic
1187940088 X:24372903-24372925 AGAGGAGGTCAAGGAGTTGAAGG + Intergenic
1188110867 X:26194758-26194780 AGAGGAGGTCTGGGAGTTCCTGG + Exonic
1188147085 X:26627641-26627663 GGAGGTTGGCAGGGAGTTGAGGG - Intergenic
1188811227 X:34656631-34656653 GGTGGATGCCAGGGAGGTGGCGG + Intronic
1189084019 X:38001149-38001171 GGAGGAGGGCAGGGAAGTGCTGG - Intronic
1189320290 X:40083492-40083514 GGAGGAGGCCGGGAAGGTTCTGG - Intronic
1190300738 X:49055546-49055568 GGAGAAGGCCAGGCAGTCACTGG + Intronic
1190496582 X:51032995-51033017 GGCAGAGCCCAGGGAGTTCCAGG - Intergenic
1190509390 X:51160942-51160964 GGCAGAGCCCAGGGAGTTCCAGG + Intergenic
1190600755 X:52089611-52089633 GGAGGGGGGCAGGGATGTGCTGG + Intergenic
1191105785 X:56771325-56771347 GGAGGAGGAGAGGAAGTTGGAGG - Intergenic
1191106778 X:56776727-56776749 GGAGGAGGAGAGGAAGTTGGAGG - Intergenic
1191792317 X:64984075-64984097 GGAGGATGGGAGGGAGGTGCAGG - Intronic
1192988286 X:76424107-76424129 GCAGCAAGACAGGGAGTTGCTGG - Intergenic
1194453925 X:94079511-94079533 GGAGGAGGAGAGGGAGGTGAGGG - Intergenic
1195200640 X:102547147-102547169 GGAGGAGGGGATGGAGTCGCTGG + Intergenic
1195992808 X:110699401-110699423 GCAGGAGTCCAGGGAATTACAGG - Intronic
1198992586 X:142532358-142532380 GGAAGAGGCCAATGAGATGCTGG - Intergenic
1199580131 X:149352227-149352249 GGAGGGGGGCAGGGAAGTGCTGG - Intergenic
1199724730 X:150568841-150568863 GGCTGAGGCCAGGGAGCAGCAGG + Intronic
1199819059 X:151426676-151426698 GGAGGGAGCCAGGGAGTGGCAGG + Intergenic
1200074280 X:153543539-153543561 GGAGGCAGCCAGGGAGGTGGGGG + Intronic
1200093394 X:153646352-153646374 GGTGGAGGGCAGGTCGTTGCAGG + Intronic
1200100582 X:153687768-153687790 GGAGGAGGGCAGGGAGGAGGTGG + Intronic
1200102974 X:153697338-153697360 GGAGGACGCCTGAGAGTTCCTGG + Intergenic
1200118880 X:153781209-153781231 GCAGGAGGCCTGTGAGCTGCGGG - Exonic
1200120613 X:153788565-153788587 GGAGAAGGCCACGGATTGGCCGG + Intronic
1201154309 Y:11115786-11115808 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1201291158 Y:12421487-12421509 GGAGGAGGCCTGGGCGCGGCTGG - Intergenic
1201564897 Y:15355497-15355519 GGTGGAGGCCAGAGGGTGGCAGG - Intergenic
1201763485 Y:17561090-17561112 GGAGGAAGCCAGGGACTGCCGGG + Intergenic
1201838068 Y:18344900-18344922 GGAGGAAGCCAGGGACTGCCGGG - Intergenic
1202369372 Y:24186707-24186729 TGAGAAGGCCAGGGTGTTGCGGG + Intergenic
1202501413 Y:25483410-25483432 TGAGAAGGCCAGGGTGTTGCGGG - Intergenic