ID: 1025132408

View in Genome Browser
Species Human (GRCh38)
Location 7:56383193-56383215
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 13, 1: 15, 2: 15, 3: 78, 4: 777}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132408_1025132419 14 Left 1025132408 7:56383193-56383215 CCCTGGCCTCCTCCCCTACTTCT 0: 13
1: 15
2: 15
3: 78
4: 777
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132408_1025132420 19 Left 1025132408 7:56383193-56383215 CCCTGGCCTCCTCCCCTACTTCT 0: 13
1: 15
2: 15
3: 78
4: 777
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132408 Original CRISPR AGAAGTAGGGGAGGAGGCCA GGG (reversed) Intergenic
900016082 1:151073-151095 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
900046346 1:509667-509689 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
900375887 1:2354588-2354610 AGAAGAGGAGGGGGAGGCCAGGG - Intronic
900382219 1:2390601-2390623 AAATGTCGGGGAGGAGGGCAGGG + Intronic
900385903 1:2410580-2410602 AGAAGCAGAGAGGGAGGCCAGGG - Intronic
900611429 1:3546185-3546207 TGAGGTGGGGGAGGAGGCCGAGG - Intronic
900732451 1:4271283-4271305 AGGACTAGGGGATGAGGACAAGG - Intergenic
901264909 1:7903019-7903041 GGAAGGAGGGGAGGAGGGGAAGG - Intergenic
901353800 1:8624633-8624655 AGAAGAAGGGGAGGAGTCCAAGG + Intronic
902099343 1:13973090-13973112 AGATGAAGGGGAGGAGGAAAAGG - Intergenic
902271856 1:15310433-15310455 AGACGCTGGGGAGGAGGGCAGGG - Intronic
902732435 1:18378081-18378103 AGTGGTAGGGGAGGAGATCATGG + Intronic
902904518 1:19545746-19545768 AGAGGTCGGGGGGGAGGGCAGGG + Intergenic
903168066 1:21534928-21534950 AGAAGGCAGGGAGGAGGACAGGG - Intronic
903212712 1:21827829-21827851 TGAAGCTGGGGAGGAGGCCATGG + Intronic
903320381 1:22539400-22539422 CAAAGTATGGGAGGAGTCCAGGG - Intergenic
903556275 1:24195895-24195917 AGAAGCGGGAGAGGAGGCGAGGG + Intergenic
903559228 1:24215512-24215534 AGCAGAAGGAGAGGAGGGCAGGG + Intergenic
903789426 1:25882361-25882383 TGGAGTAGGAAAGGAGGCCATGG - Intergenic
903961282 1:27059263-27059285 AGAAGGAGGGGAGGGAGCGAAGG + Intergenic
904166761 1:28561591-28561613 AGTAGCAGGGTAGGAAGCCAGGG - Intronic
904277490 1:29393929-29393951 AGAAGGAGGGGAGGAGGGGAGGG - Intergenic
904453130 1:30629420-30629442 AGAGGAAAGGGAGGAGGGCAGGG + Intergenic
905336464 1:37248039-37248061 AGATGTAAGGGTGAAGGCCAAGG + Intergenic
905649377 1:39646319-39646341 AGGAGCGGGGGAGGAGGGCAAGG - Intergenic
906036711 1:42755032-42755054 GGAAGTCGGGGTGGAGCCCAGGG - Intronic
906566385 1:46804119-46804141 AGACGCAAGGGAAGAGGCCAAGG + Intronic
907528552 1:55070016-55070038 AGAAGCAGGGGTGGAGGTGAGGG + Intronic
907560800 1:55385707-55385729 AGAGGTAGGGGAGGAAGGGAGGG - Intergenic
909213118 1:72849674-72849696 AGAAGGAAGGGAGGAGGGAAGGG - Intergenic
910322818 1:85968038-85968060 AGATGTAGGCTAGGAGGCTAGGG - Intronic
910806755 1:91195832-91195854 AGAAGCAGGGGAAGATGCTAAGG + Intergenic
912517597 1:110226041-110226063 GGGGGTCGGGGAGGAGGCCAGGG - Exonic
912551380 1:110487581-110487603 AGAAAGAGGGGAGGATGGCAGGG + Intergenic
912895219 1:113579441-113579463 AGAATTTGGGGAGGTTGCCAGGG + Intronic
912945189 1:114078781-114078803 AGAAGCAGGGCAGGAGGCAGTGG - Intergenic
913109870 1:115648248-115648270 AGCACTGGGGGAGGAGGACAAGG + Intronic
913252080 1:116920038-116920060 AGAAGATGGGCAGGAAGCCAGGG - Intronic
913454610 1:119018602-119018624 AGAGGTAGGTGAGTAGTCCAGGG + Intergenic
914826023 1:151138482-151138504 AGGGGTTGGGGAGGAGGCAACGG - Intronic
914866050 1:151430024-151430046 AGAAGTGGGGGTGGGGGGCAGGG + Intronic
915557778 1:156669889-156669911 AGGAGGAGGGGAGGGAGCCAGGG - Exonic
915709310 1:157879228-157879250 AGAAATAGGAGAGGAGGTAATGG - Intronic
916199706 1:162258462-162258484 AGAAGTAGTGGTGGATTCCATGG - Intronic
916476836 1:165177636-165177658 AGAAGTAGGAGATGTGGCAATGG + Intergenic
916935992 1:169628721-169628743 TGAAATAGAGGAGGATGCCAAGG + Intronic
917020032 1:170576469-170576491 AGAAGTAGGGAAAGATGCAAAGG - Intergenic
917174852 1:172222439-172222461 AGAAGTTGGTGAAGAGGCCAAGG + Intronic
917359335 1:174159440-174159462 AGAAGGAGGGGAGGAGGCGGTGG - Intronic
917454766 1:175176985-175177007 AGAATGAGGGGATGAGGCTAAGG - Intronic
918206020 1:182310091-182310113 AGAAGCAGGGTAGGAAGCCTGGG + Intergenic
919133162 1:193476118-193476140 AAAAGATGGGGAGGAGGACAGGG - Intergenic
919595863 1:199561608-199561630 AGAAGAAGAGGAGGAGGAGAAGG - Intergenic
920102623 1:203526837-203526859 AGAGGCAGGGGAGTGGGCCAAGG - Intergenic
920292041 1:204929964-204929986 AGATGGAAGGGAGGTGGCCATGG + Intronic
921278553 1:213543231-213543253 AGAAGTAGGGGAGCAAGGAAAGG + Intergenic
921348800 1:214214453-214214475 AGGGGCCGGGGAGGAGGCCAGGG - Intergenic
921434775 1:215105727-215105749 AGAAGGAAGGGAGGAGGGCAGGG - Intronic
921749695 1:218777923-218777945 AGAGGCAGGGGAGGTGGTCAAGG + Intergenic
922101592 1:222481830-222481852 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
922101649 1:222482133-222482155 AGAATTAGGGGAGGGAGCCAGGG - Intergenic
922103903 1:222496751-222496773 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
922262673 1:223956946-223956968 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
922262729 1:223957249-223957271 AGAATTAGGGGAGGGAGCCAGGG - Intergenic
922264224 1:223969282-223969304 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
922724390 1:227915675-227915697 AGGAGTAGGGGAGGAGGTGAAGG - Intergenic
923239972 1:232074159-232074181 ATAAGTGGGGGAGGAAACCAAGG + Intergenic
923339047 1:232992452-232992474 AGATGGAGGGCAGGAGGCAAGGG + Intronic
923642130 1:235774342-235774364 AGAAGTAGGGGTGGAGGCAAGGG + Intronic
924010715 1:239662753-239662775 AGAAGTAGAGGAGGAGGAGGAGG - Intronic
924194489 1:241591443-241591465 AGAAATAGGCCAGGATGCCATGG + Intronic
924327303 1:242908913-242908935 AGAAGGAGGGGAGGAGGAAGGGG - Intergenic
924344512 1:243061947-243061969 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
924344567 1:243062250-243062272 AGAATTAGGGGAGGGAGCCAGGG - Intergenic
924346073 1:243074275-243074297 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
924440761 1:244083384-244083406 AGAAGTGGGGAGGGAGGGCAGGG - Intergenic
924813973 1:247426719-247426741 AGATGTCGGGGAGGGGGTCATGG + Intronic
1063128302 10:3154807-3154829 CGAAGGAAGGGAGGAGGCCACGG - Intronic
1063150391 10:3331598-3331620 AGAAGTTGTGGAAGAAGCCATGG + Intergenic
1063666151 10:8061904-8061926 CCAAGTAGGGGAGGAGCCCGAGG + Intronic
1064134376 10:12737577-12737599 AGAAGTAAGAGGCGAGGCCAAGG - Intronic
1064153286 10:12883325-12883347 AGAAGGGGGACAGGAGGCCAAGG + Intergenic
1064242630 10:13645022-13645044 AGACTTGGTGGAGGAGGCCACGG + Exonic
1064555070 10:16539778-16539800 AGAGGTAGAGGAGGAGGGCAGGG - Intergenic
1064588905 10:16868189-16868211 CTAAGTAGGGGAGGTGGCAAAGG + Intronic
1065338062 10:24675307-24675329 AGAAGAAGAGGAGGAGGAGAAGG + Intronic
1065365674 10:24934558-24934580 AGGAGTTGTGGAGGAAGCCAAGG - Intronic
1065697754 10:28395530-28395552 AGAAGTAGTGGAGGAGAAGAAGG - Intergenic
1065761578 10:28987791-28987813 AGAAGAAGGGGAAGAGGAGAAGG - Intergenic
1065920843 10:30391583-30391605 AGAGGTTGGGGAGGAGGAAAAGG - Intergenic
1066576453 10:36831051-36831073 ACAAGTAGGGGAAGAGTCTAAGG + Intergenic
1066653207 10:37678980-37679002 AGAAGTACCCCAGGAGGCCAGGG - Intergenic
1066730273 10:38430545-38430567 TGAAGTCAGCGAGGAGGCCAGGG + Intergenic
1066731764 10:38442822-38442844 AGAATTAGGGGAGGGAGCCAGGG + Intergenic
1066731821 10:38443125-38443147 AGAAGTAGGGGAGGAGGCCAGGG + Intergenic
1067171503 10:43910592-43910614 AGAAGGATGGGAGGAGCCCTGGG + Intergenic
1067941899 10:50663595-50663617 TGAAGTGGGGGTGGGGGCCAAGG + Intergenic
1068620515 10:59176737-59176759 AGAGGGAGGGAAGGAGGCCTGGG - Exonic
1069551602 10:69368163-69368185 GGAAGTGGGGAAGGGGGCCAGGG + Intronic
1069907522 10:71740523-71740545 AGAGGTAGGTCAGGAGGTCAAGG + Intronic
1069957882 10:72062810-72062832 GGAAGCAGGCGAGGAGGCCGAGG - Exonic
1070327551 10:75398690-75398712 AGGGGGAGGGGAGGAGTCCAGGG - Exonic
1070450059 10:76549095-76549117 AGAAGAAGGGGAGGTGGGGAAGG - Intronic
1070746292 10:78935942-78935964 AGTGGGAGAGGAGGAGGCCAAGG - Intergenic
1070863142 10:79688546-79688568 TGAAGTGGGGGTGGGGGCCAAGG + Intergenic
1070917754 10:80165748-80165770 AGAAGAGGGGTAGGAGGCCATGG - Intronic
1071378744 10:85036323-85036345 GGAAAGAGGGGAGGAGGCAAGGG + Intergenic
1071472430 10:85993158-85993180 AAGAGAAGAGGAGGAGGCCAGGG + Intronic
1071585874 10:86820676-86820698 AGAAGTCCGGGGGGAGGGCAAGG - Intronic
1071591022 10:86873335-86873357 AGCACTCTGGGAGGAGGCCAAGG + Intronic
1071907562 10:90190764-90190786 AGGAGTAGGGAAGCAGGCTAGGG + Intergenic
1072362624 10:94674575-94674597 AGATGCAGGGCAGAAGGCCATGG - Intergenic
1072633219 10:97161196-97161218 GGAAGGAGGGGAGGAGGGAAAGG - Intronic
1072733283 10:97862763-97862785 AGAATAAGGGGAGGATGTCACGG + Intronic
1073019858 10:100434085-100434107 AGGTGTAGGGGAGGGCGCCAGGG + Intergenic
1073051493 10:100670168-100670190 AGACAGAAGGGAGGAGGCCAAGG - Intergenic
1074081053 10:110168550-110168572 AGATGAAGGGGAGGAGGTGAAGG - Intergenic
1074447254 10:113530624-113530646 AGCAGTAGGGGAGGGGGAGATGG + Intergenic
1075734351 10:124654815-124654837 AGAAGGAGGTAAGGAGGCCCCGG + Intronic
1075934003 10:126324204-126324226 AGAATTTGGCCAGGAGGCCAGGG + Intronic
1076135235 10:128041005-128041027 GGTAGTAGGGGAGGCAGCCAGGG - Intronic
1076257898 10:129042871-129042893 AGAAGGAGGGGAGGAGGGAAGGG - Intergenic
1076288990 10:129329688-129329710 AGCAGTGGGGGAGGAGGCAGTGG - Intergenic
1076294880 10:129376486-129376508 ACAAGTAAGGGAGGGGCCCAGGG + Intergenic
1076422322 10:130340186-130340208 AGCAGGTGGGGAGGAGGCCGTGG + Intergenic
1076475587 10:130749651-130749673 AAAGGCAAGGGAGGAGGCCAGGG + Intergenic
1076588999 10:131570413-131570435 AGAAGGAGGGGAGCAGGGGAGGG + Intergenic
1076718769 10:132383342-132383364 AGAAGTGGGGGAGGAGGCAGGGG - Intergenic
1076972672 11:146140-146162 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
1077362939 11:2148812-2148834 AGGGGTAGGGGAGGAGGGCTAGG - Intronic
1077557235 11:3231559-3231581 AGAAGGAGGGGAGGAGGCGGGGG + Intronic
1077633335 11:3825578-3825600 AGAAGGAAGGGTGTAGGCCAAGG + Exonic
1077875454 11:6301276-6301298 AGAAAGAGGGCAGGAGGACAGGG - Intergenic
1078095087 11:8291841-8291863 AGAGATGGTGGAGGAGGCCAGGG + Intergenic
1078258923 11:9685880-9685902 AGCACTTTGGGAGGAGGCCAAGG - Intronic
1078340472 11:10495110-10495132 AGAGGGAGGGGAAGGGGCCAGGG - Intronic
1078399276 11:11009994-11010016 AGAGGGAGGGGAGAAGGACATGG + Intergenic
1080663752 11:34317953-34317975 AGAGGTAGGGGAGGGGGACGTGG - Intronic
1082261955 11:50083285-50083307 AGAAGTAGGGGAGAAGGCCAGGG - Intergenic
1083592387 11:63903323-63903345 GGAAGATGGGGAGGAGGCAATGG - Intronic
1083649613 11:64194031-64194053 AGGAGTAGGCTACGAGGCCAAGG - Intronic
1083673462 11:64312924-64312946 AGAAGCAGGGGCGTAGGCCTAGG + Intronic
1083721696 11:64606710-64606732 AGAAGTAGGGAAGGAGGGTGGGG + Exonic
1083794247 11:65005503-65005525 AGAGATTGGGGTGGAGGCCACGG + Intergenic
1083904020 11:65658544-65658566 AGAAGTTGAGGGGGAGACCATGG - Intronic
1084596793 11:70121330-70121352 AGAGGTGGGGGAGGAAGACAGGG - Intronic
1084765030 11:71302635-71302657 AGAAGAAGAGGAGGAGGAGAAGG - Intergenic
1085235673 11:75013419-75013441 AGAAAGAGGGGAGGAAGGCAGGG + Intronic
1085407189 11:76270255-76270277 AGCAGCAGGGGAGGAGACCTTGG - Intergenic
1085513675 11:77100350-77100372 AGAGGGAGGGGAGGAGGCAGAGG - Intronic
1085716539 11:78878523-78878545 AGAAGTGGGGTAGGAGGTGATGG + Intronic
1086209145 11:84297203-84297225 AGAAGTTTGGGAGGAGGTTAAGG + Intronic
1086450525 11:86911460-86911482 AGGAGGATGGAAGGAGGCCAGGG - Intronic
1087361462 11:97165722-97165744 AGGAGTAGGAGATGAGGTCAAGG + Intergenic
1087375131 11:97330141-97330163 AGAAGAAGGGGAGCAGGCTGGGG - Intergenic
1087632127 11:100662142-100662164 AGAAGTAGAAGAGGATGCCTAGG - Intergenic
1087768328 11:102180263-102180285 AGAAATAGATTAGGAGGCCAAGG - Intronic
1088015974 11:105060638-105060660 AGAAGGAGGTGTGGGGGCCATGG - Intronic
1088047631 11:105472846-105472868 AGAAGAAGGGGAGGAGGAGGAGG + Intergenic
1088264696 11:107978046-107978068 AGATGTAGGCTGGGAGGCCAGGG - Intergenic
1088695478 11:112362480-112362502 AGAAGTAGGAAATGAGGGCAGGG + Intergenic
1088879948 11:113965254-113965276 AGAAATAGAGGAGGCAGCCAAGG + Intergenic
1088891076 11:114044686-114044708 GGGAGTAGGAGAGGAGGGCATGG - Intergenic
1089608963 11:119658815-119658837 AGCAGGAGGGGAGGAACCCAGGG - Intronic
1089750013 11:120644703-120644725 AGTAGAAGGGGAGAAGGCGAAGG + Intronic
1089760177 11:120717366-120717388 AGAAGTAGGGAAGAAGCCCCAGG - Intronic
1089849073 11:121481348-121481370 AGAAGCTGGGGAGGAGGAGATGG - Intronic
1089879751 11:121762471-121762493 AGAAGGAGGGGAGGGGAACAGGG + Intergenic
1090264739 11:125346833-125346855 GGAAGGAGGGGAGGAGGTCAGGG + Intronic
1090779721 11:129996635-129996657 AGAACTAGGAGAGGAGGGGAAGG + Intronic
1092127470 12:6085053-6085075 AGAAGTAGGAGACTTGGCCATGG + Intronic
1092166918 12:6348038-6348060 GGAAGGAGGGGAGGATGCCAGGG + Exonic
1092551114 12:9501278-9501300 AGAAGGAAGGGAGGAAGGCAGGG - Intergenic
1092650787 12:10632472-10632494 AGTAGTAGGAGACAAGGCCAGGG + Intronic
1092750557 12:11715316-11715338 AGATGAAGAGAAGGAGGCCAAGG + Intronic
1092843329 12:12562920-12562942 AGAGGTGGGGGAGGAGGCCGCGG - Intergenic
1094155820 12:27335809-27335831 AGGAGAAGGGGAGGAGGGGAGGG + Intronic
1094203576 12:27817376-27817398 AGAAGAAGGAGGGGAGGGCAGGG - Intergenic
1094231419 12:28108454-28108476 AGGAGGATGGGAGGTGGCCAAGG + Intergenic
1094354576 12:29564372-29564394 AGATGTAGGGAAGGAGGAGAGGG + Intronic
1094426425 12:30321352-30321374 AGCAGTAGGGGATGTTGCCATGG - Intergenic
1094614923 12:32027845-32027867 AGAAGTAAGGACTGAGGCCATGG - Intergenic
1094703655 12:32894964-32894986 AGAAAAATGGGAGGGGGCCACGG + Intronic
1095351380 12:41217688-41217710 AGAAGAAGGAGAGGAGGCTGTGG - Intronic
1095994906 12:48073001-48073023 AGAAGGAGGGAAGGGGGACAGGG + Intronic
1096105056 12:48992371-48992393 AGAAGTAGGGGAGGACGGCCAGG - Intergenic
1096716395 12:53493924-53493946 AGAAGTAGGAGATGGGACCAAGG + Intronic
1097050683 12:56221506-56221528 AGAAGTGCGGGAGGGGGCCGGGG - Intronic
1097140125 12:56895325-56895347 AGCACTCTGGGAGGAGGCCAAGG - Intergenic
1097196282 12:57243929-57243951 AGAAGTAGGAGAGGAATCAAAGG + Intronic
1097799015 12:63892179-63892201 AGAGGTAGGGAAGGAGGGAATGG - Intronic
1098169160 12:67728796-67728818 AGAACTAGGGGAGGTGGGAAAGG - Intergenic
1098560853 12:71870233-71870255 AGGAGAAGGGGAGGAGGAAAGGG - Intronic
1099010485 12:77285426-77285448 AGGAGTAGAAGAGGAGGACAAGG + Intergenic
1099136496 12:78910302-78910324 AGAACTAGGCAAGGAGGTCAGGG - Intronic
1099685007 12:85874124-85874146 AGAAATGGGGGAGGAGAGCAGGG + Intergenic
1099829352 12:87820684-87820706 AGAAGTAGAGGAAGAGGACATGG - Intergenic
1099959199 12:89380458-89380480 GGAAGCAGGGGAGGAGGGAATGG - Intergenic
1100171210 12:91977012-91977034 GGAAGTAGAGGAGGGGTCCAAGG - Intergenic
1100405317 12:94267833-94267855 AAAAGAAGGGGAGGAGGGAAGGG - Intronic
1101007047 12:100411165-100411187 AAAAATAGGGGAAGAGGCCAGGG + Intronic
1101450610 12:104775120-104775142 AGAAGAAGAGGAGGAGGCGGAGG - Intergenic
1101597067 12:106177267-106177289 AGGAGTGGGTGAGGAGGCAATGG - Intergenic
1101653113 12:106695451-106695473 AGGTGTAGGGGAGGCGGCAAGGG + Intronic
1102027881 12:109723751-109723773 AGGAGGAGGGGCGGAGGCCCAGG - Intronic
1102029308 12:109730848-109730870 AGCAGCGGGGGAGGAGGGCAGGG - Intronic
1102347110 12:112167409-112167431 AGAAGGAGGGCAGGAGGTCCAGG + Exonic
1102796328 12:115691913-115691935 AGAAGAAGGGGAGGAGAGAAAGG - Intergenic
1102924024 12:116813207-116813229 AGCACTTTGGGAGGAGGCCAAGG - Intronic
1103053205 12:117798667-117798689 AGAAATAGAGGAGGAGGAAAAGG + Intronic
1103134676 12:118497485-118497507 AGAAGTAAGAGATGAGGCTAAGG - Intergenic
1103738196 12:123073952-123073974 CTCAGTATGGGAGGAGGCCAAGG - Intronic
1104043725 12:125146848-125146870 AGCACTTTGGGAGGAGGCCAAGG + Intergenic
1104051354 12:125195923-125195945 AGCAGGAGGAAAGGAGGCCAGGG + Intronic
1104110312 12:125698370-125698392 GGAAGGAGGGGAAGAGGCCCTGG + Intergenic
1104299307 12:127549780-127549802 AGAAGGGAGGGAGGGGGCCATGG - Intergenic
1105357386 13:19671068-19671090 AGATGTTGTGGAGGAGGCCAAGG - Intronic
1105752973 13:23438858-23438880 AAGAGTAGGGGAGGGGGCCAAGG + Intergenic
1105994177 13:25654452-25654474 AGCACTTTGGGAGGAGGCCAAGG - Intronic
1106181445 13:27372899-27372921 AGAAATAGAGGAGCAGTCCAGGG - Intergenic
1106338712 13:28808238-28808260 AGAAGCAGGGCAGAAGGCAAAGG - Intergenic
1106589348 13:31086201-31086223 AGGAGGAGCTGAGGAGGCCAAGG - Intergenic
1107650511 13:42540388-42540410 TGAGGTAGGGGAGGAGACGAGGG + Intergenic
1109048138 13:57439694-57439716 AGAAGTGGAGAGGGAGGCCAAGG + Intergenic
1109734590 13:66466188-66466210 AGAAGGAGGGGAGGAGAGGAGGG - Intronic
1110786527 13:79534719-79534741 AGAATTAGGTGAGGAGTCAAGGG + Intronic
1110845615 13:80187752-80187774 AGAGGTAGTGGAGGGGGGCAGGG - Intergenic
1111540000 13:89657293-89657315 AGAACTAGGGTAGGAGCCCCAGG - Intergenic
1111897169 13:94156002-94156024 AGAAGTAGGGTAGCATGCCTGGG + Intronic
1111929801 13:94501966-94501988 AGAAGTAGGGGCTGAGGCTATGG - Intergenic
1111929822 13:94502070-94502092 AGAAGTAGGGGCTGGGGCTATGG - Intergenic
1111929845 13:94502174-94502196 AGAAGTAGGGGCTGGGGCTATGG - Intergenic
1111958138 13:94780565-94780587 AGCACTTTGGGAGGAGGCCAAGG - Intergenic
1112278671 13:98044055-98044077 AGGAGCAGGGGAGGAGTCAATGG + Intergenic
1112619577 13:101040915-101040937 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
1112947877 13:104954716-104954738 AGAAGTAGGGAAGGTGACCCAGG + Intergenic
1113236273 13:108278629-108278651 AGAAGTGGAGGAGGAGGAAAGGG - Intronic
1113274280 13:108711176-108711198 ACAAGAAGTTGAGGAGGCCAAGG - Intronic
1113654320 13:112058434-112058456 AGGTGCAGGGGAGGAGGCCGGGG - Intergenic
1114151417 14:20044125-20044147 AGGAGTAGCAAAGGAGGCCAGGG - Intergenic
1114499042 14:23154481-23154503 ACAAGCGGGGGAGGCGGCCAAGG - Intronic
1115298873 14:31861564-31861586 AGAAGGAGGAGAAGAGGGCAGGG - Intergenic
1115799592 14:36977523-36977545 AGGAGTTTGGTAGGAGGCCATGG - Intronic
1117579856 14:57141733-57141755 AGAAGTAAGGGTGGAGGTTAGGG - Intergenic
1118283815 14:64452969-64452991 AGCACTTTGGGAGGAGGCCAAGG - Intronic
1118459555 14:65976046-65976068 AGAAGGAGGGGAAGAGGAGAAGG + Intronic
1118465272 14:66024910-66024932 AGAAGGGGAGGAGGAGACCAGGG + Intergenic
1118680344 14:68235349-68235371 AGCAGAAGAGGAGGGGGCCAAGG + Intronic
1119067394 14:71542614-71542636 AGAAGAAGGGGAGGAGGAGGGGG - Intronic
1119885221 14:78134714-78134736 AGAAGTGGGACAGGAGGGCAGGG - Intergenic
1120045582 14:79801969-79801991 AGTAGTATGAGAGGAAGCCAAGG + Intronic
1120071065 14:80103187-80103209 AGAAGAATTGCAGGAGGCCAAGG + Intergenic
1120308853 14:82804748-82804770 AGAAGCAGGGGAGTAGGGAAAGG + Intergenic
1122126049 14:99579353-99579375 AGAAGTGGGGGAGGGGGGCAGGG + Intronic
1122323452 14:100868868-100868890 AGAGGGAGAGGAGGAAGCCAGGG - Intergenic
1122383825 14:101330627-101330649 AGATGAAGGGGAGGAAGCTACGG + Intergenic
1122672910 14:103385690-103385712 AGAAGGAGGTGAGGGGGCCCAGG + Exonic
1122812880 14:104297667-104297689 AGGAGGAGGAGAGGGGGCCAGGG + Intergenic
1123633838 15:22282534-22282556 TGAAGAAGGGGAGGATTCCAAGG - Intergenic
1123721307 15:23064118-23064140 AGCAGTGGGGGAAGAGGCCGTGG - Intergenic
1124198143 15:27651657-27651679 AGCCTTTGGGGAGGAGGCCAAGG + Intergenic
1124668359 15:31614148-31614170 GGAAGAATGGGAGGAGGGCAAGG + Intronic
1124808813 15:32913540-32913562 TGAAGAAAGGGAGGAAGCCATGG - Intronic
1125073709 15:35588073-35588095 AGAAGTAGGGGAAAAGGCTCAGG - Intergenic
1125551083 15:40545367-40545389 AGTAGAAAGGGAGGAGGCAAAGG - Intronic
1125741698 15:41969757-41969779 AGAAGGAGGGGAGATGGGCATGG - Intronic
1125797692 15:42415697-42415719 AAAATTGGGGGAGGAGCCCAGGG - Exonic
1126560038 15:50033699-50033721 AGGAGAAGGGGAGCAGGACAGGG - Intronic
1127245494 15:57168793-57168815 AGCACTTTGGGAGGAGGCCAAGG + Intronic
1127484791 15:59408968-59408990 AGAAGTAGGGAAAGAGAACAAGG - Intronic
1128721728 15:69955264-69955286 AGAATTAGCAGAGGAGGCCTAGG - Intergenic
1129227045 15:74176106-74176128 AGAAGAAGAGGAGGAGGCTTTGG - Exonic
1129239799 15:74244572-74244594 AGAAGGAGGGGAGGAGGGGAGGG - Intronic
1129378971 15:75153777-75153799 AGAAGTAGGGAGGGAGGCTGTGG + Intergenic
1129755399 15:78094983-78095005 CTAAGTAGGGAGGGAGGCCAGGG + Intronic
1130041200 15:80406160-80406182 AAGAGTAAAGGAGGAGGCCAAGG + Intronic
1130599671 15:85266739-85266761 AGGAGTATGGGAGGAGACCGAGG + Intergenic
1131091918 15:89629946-89629968 AGTGGTGGGGGTGGAGGCCAGGG - Intronic
1131105723 15:89732949-89732971 CGGGGTAGGGGAGGAGGCCATGG - Intronic
1131290512 15:91102819-91102841 GGAAGTGAGGGAGGAAGCCAGGG + Intronic
1132227207 15:100151640-100151662 AGAAGTAGGGGAACCAGCCAGGG - Intronic
1132397362 15:101483732-101483754 AGAAGCAGGGGAGAAGGGAAGGG + Intronic
1132551634 16:556156-556178 GGAAGGAGGCGAGGAGGCCACGG - Intergenic
1132724244 16:1332076-1332098 GGAAGCAGGGGAGGGGGCCTGGG - Intergenic
1133666102 16:7969350-7969372 AGATGTAGGGAATGAGGCCCAGG - Intergenic
1133772271 16:8874130-8874152 AGCACTTTGGGAGGAGGCCAGGG - Intergenic
1134013038 16:10869237-10869259 AGGAGTAGGGGATGAGAGCAGGG - Intergenic
1134213490 16:12297499-12297521 AGGAGAAGGGAAGGAAGCCAGGG - Intronic
1135143763 16:19943888-19943910 TGAAGTAGGAGAGGATGACAAGG - Intergenic
1135518621 16:23156271-23156293 AGAAATAGGGGAGGAGGGAGAGG + Intergenic
1136539122 16:30918880-30918902 AGAAGAAGAGGAGGAGGAGAAGG - Intergenic
1136539129 16:30918989-30919011 AGAAGAAGAGGAGGAGGAGAAGG - Intergenic
1137613505 16:49834497-49834519 GGAAGAATGGGTGGAGGCCAGGG + Intronic
1137801027 16:51262165-51262187 AGAAGGAGGGAAGGAGGGAAGGG - Intergenic
1138235998 16:55383176-55383198 AGGGGTAGGTGAGGAGCCCAAGG + Intergenic
1138436261 16:57001890-57001912 GGAAGTATAGTAGGAGGCCAGGG - Intronic
1139196245 16:64921640-64921662 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
1139196275 16:64921811-64921833 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
1139328465 16:66169593-66169615 AGAAGAAGAGGAGGAGGAGAGGG + Intergenic
1139420838 16:66848721-66848743 TGAACTGGGGGAGGAGGCTAAGG + Intronic
1139431333 16:66912475-66912497 AGACGCAGGGGAGAAGGCCTTGG - Intronic
1139557855 16:67724029-67724051 AGAAAATGGGGAGGTGGCCATGG + Exonic
1139775968 16:69317154-69317176 CGAGGCAGGGGTGGAGGCCAGGG + Intronic
1140465369 16:75176826-75176848 GGAAGCAGGGGAGGAAGGCAGGG + Intergenic
1140663978 16:77212385-77212407 AGGAGTGGGCGAGGAGGGCAGGG + Intronic
1140828745 16:78731711-78731733 AGAAGAAGCGGATAAGGCCAGGG + Intronic
1140964343 16:79950239-79950261 AGCAGGAGGGGAGGAAGACATGG + Intergenic
1140997066 16:80271467-80271489 AGAAGTTGGGAAAGAGGCCTGGG + Intergenic
1141110587 16:81267914-81267936 AGAAGCAGGGGAAGAGCCCCTGG + Exonic
1141206260 16:81935240-81935262 AGCAGAAGAGGAGAAGGCCAAGG - Intronic
1141255716 16:82400673-82400695 GGAAGTGTGGGAGGAGGACAAGG - Intergenic
1141592550 16:85078164-85078186 TGGGGTAGAGGAGGAGGCCAAGG - Intronic
1141664857 16:85460801-85460823 AGAAGGAGCTGAGGAAGCCAGGG + Intergenic
1142193775 16:88730004-88730026 AGAAGAAGGGGAGCTGGCCTAGG + Intronic
1142447577 16:90151382-90151404 CGAAGTCAGCGAGGAGGCCAGGG + Intergenic
1142459916 17:83941-83963 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
1142781626 17:2185751-2185773 AGAAGACGGGGACGAGGGCAGGG + Intronic
1142876932 17:2856801-2856823 AGAAGAACGGGATGAAGCCAGGG - Intronic
1143557841 17:7673662-7673684 AGAAGCGGTGGAGGAGACCAAGG - Intronic
1143756330 17:9070524-9070546 ACAAGTAGGGCAGGAGACTAAGG - Intronic
1144041387 17:11414104-11414126 AGAAGGAGGAGAGGAGGGAAAGG - Intronic
1144126785 17:12210407-12210429 AGAAGAAGAGGAGGAGGAGAGGG - Intergenic
1144224909 17:13135787-13135809 AGAAGGAGGAGTGGAGCCCAGGG + Intergenic
1144726090 17:17503539-17503561 AGATGGAGGGAAGGAGGCCGCGG + Intergenic
1145826980 17:27884476-27884498 AGAAGATGGGAAGGAGTCCACGG - Intronic
1145929514 17:28675089-28675111 GGAAGAAGGGCAGGAGGCCATGG + Exonic
1146410750 17:32582021-32582043 AGCACTTTGGGAGGAGGCCAAGG - Intronic
1146449830 17:32964233-32964255 TTAAGCAGGGGAGGAGACCAGGG + Intergenic
1146674160 17:34761358-34761380 AGAGGTAGGGGAGGGAGACAGGG + Intergenic
1146792731 17:35761824-35761846 AGAGGAAGGGGAGGAGGAAAAGG - Intronic
1147110348 17:38257076-38257098 AGGAGGAGGGGAGGAGGCGGAGG + Intergenic
1147194754 17:38758590-38758612 AGCACTTAGGGAGGAGGCCAAGG - Intronic
1147215910 17:38898933-38898955 TGATGTGGGGGAGGAGGCCAAGG - Intronic
1147499161 17:40945665-40945687 AGAAGGTGAGGAGGAGGGCAGGG + Intergenic
1147649055 17:42051536-42051558 ACAACTTGGGGAGGAGGCTAGGG + Intronic
1147742023 17:42675246-42675268 GGAGGTGGGGGAGGGGGCCAGGG + Intronic
1148051746 17:44772982-44773004 AGAAGAATGGGAGGAGGGCCAGG - Intronic
1148185646 17:45641643-45641665 AGAAGGAGGGAAGGAAGCAAAGG + Intergenic
1148419162 17:47531355-47531377 AGGAGGAGGGGAGGAGGCGGAGG - Exonic
1148563816 17:48621433-48621455 AGAAGTAGGGGAGCAGGGGGAGG + Exonic
1148618778 17:49019021-49019043 TGAAGGAAGGGAGGAGGGCAAGG - Intronic
1148798619 17:50209696-50209718 AGGAGACGGGAAGGAGGCCATGG + Intergenic
1149003092 17:51777174-51777196 GGAAGGATGGGAGGAGGCCTTGG + Intronic
1149077463 17:52613419-52613441 GGAAGAAGGCGAGGAGGACAAGG - Intergenic
1149288607 17:55193765-55193787 ACAAGCAGAGGAGGAGGCCCAGG - Intergenic
1149302735 17:55319553-55319575 AGCAGTGGGGGTGGAGGGCAGGG + Intronic
1149324801 17:55519131-55519153 AGAAGTAGGGTAGGAGTGCTGGG + Intergenic
1149521111 17:57318902-57318924 AGAAGCAGGGAAGCAGGCTAGGG + Intronic
1149766098 17:59279956-59279978 AAAAGTGGGGGAGGAGGCGTGGG - Intergenic
1149808660 17:59644359-59644381 AAAAGTAGGAGAGCAGGCCCAGG + Exonic
1149851632 17:60039825-60039847 GGAAGTAGGGGAGTAGGTCTTGG - Intergenic
1150004930 17:61463569-61463591 AGAAGGAGAGGGGAAGGCCAGGG + Intronic
1150436829 17:65160428-65160450 AGAAATGGTGGAGGGGGCCAAGG + Intronic
1151308789 17:73280757-73280779 AGAGTTTTGGGAGGAGGCCAAGG + Intergenic
1151653261 17:75483167-75483189 AGGAGCAGGAAAGGAGGCCAGGG + Intronic
1151849405 17:76681542-76681564 GGAAGGGGAGGAGGAGGCCAAGG - Intronic
1152000428 17:77641892-77641914 AGAGGAAGAGGAGGAGGACAAGG + Intergenic
1152242874 17:79169380-79169402 AGGAGCAGGGGAGGAGGAGAGGG - Intronic
1152447365 17:80353588-80353610 AGAGGTGGCAGAGGAGGCCATGG + Exonic
1152614755 17:81332849-81332871 AGAAGTAAGAGAGGAAGCCAAGG - Intergenic
1152658285 17:81530129-81530151 GGAAATTGGGGAGGAGCCCAGGG + Intronic
1153051149 18:904670-904692 AAAAGAAGGGGAGGAAGGCAAGG - Intergenic
1153233314 18:2961645-2961667 AAAAGTTGGGGATGGGGCCAAGG - Intronic
1153934477 18:9908941-9908963 GTAAGTAGGAAAGGAGGCCATGG - Intergenic
1153995820 18:10440552-10440574 AGAAGTACAAGAAGAGGCCATGG + Intergenic
1154051286 18:10961411-10961433 GGAAGTGTGGGAGGAGGCAAGGG + Intronic
1154220694 18:12451018-12451040 AGAAGGAGGGGAGGAGGAGGAGG + Intronic
1154318829 18:13327832-13327854 AGAAGCAAAGCAGGAGGCCAGGG - Intronic
1154472858 18:14721873-14721895 AGAAGCAAGGGAGGAGGCCAGGG + Intergenic
1155035675 18:22022943-22022965 AGAAGTCGGGGATGACTCCAAGG + Intergenic
1155166361 18:23235478-23235500 AGGAGCAGGGTAGGAGGCCATGG + Intronic
1156185291 18:34655349-34655371 GGAGGTGGGGGAGGAGGCCTTGG - Intronic
1156461397 18:37323245-37323267 GGCAGCAGGGGAGGATGCCAGGG + Intronic
1156723851 18:40103717-40103739 AGAAGTAAGGCAGGAAGGCAGGG - Intergenic
1157474597 18:48013487-48013509 AGAAGTAAAAGAGAAGGCCACGG - Intergenic
1157570253 18:48707540-48707562 AGAAGAAGAAGAGGAGGACAAGG - Intronic
1158866627 18:61643921-61643943 AGAAGTAGGGAAGCAGTCCCGGG + Intergenic
1158926588 18:62270309-62270331 AAAAGTAGGGAAGTAAGCCAGGG + Intronic
1159200446 18:65176942-65176964 AGAAGAAGGGGAGGAGAAAAGGG + Intergenic
1159258104 18:65975279-65975301 AGATGTTGGGGAGGTGGGCAAGG + Intergenic
1159463121 18:68745113-68745135 AGAGGTAGGAGAGGAGGCAGTGG + Intronic
1159753415 18:72331778-72331800 TGAAGCAGGGGAGTTGGCCATGG + Intergenic
1160125484 18:76167938-76167960 AGATGAAAGGGAGGAAGCCATGG + Intergenic
1160649631 19:216449-216471 CGAAGTCAGCGAGGAGGCCAGGG - Intergenic
1160933336 19:1581063-1581085 AGCAGCAGGGGACCAGGCCAAGG + Intronic
1160989116 19:1853401-1853423 AGGAGAAGGAGGGGAGGCCAGGG + Exonic
1161214187 19:3085109-3085131 ACAAGGAAGGGAGGAGGCCGTGG + Intergenic
1161324914 19:3658958-3658980 AGAGGGTGGAGAGGAGGCCAAGG - Intronic
1161440959 19:4291411-4291433 AGAAGTAGGGGAGGGGAGCTGGG + Intergenic
1162372189 19:10286295-10286317 AGCAGTGGGGAAGGGGGCCAAGG + Exonic
1162438485 19:10678250-10678272 AGAACATGGGGAGGAGGCAAGGG + Intronic
1162962439 19:14136130-14136152 GGCAGTGGGGGAGGAGGTCACGG + Intronic
1163106810 19:15128089-15128111 AGACGTAGAGGAGGAGGGCCGGG - Intergenic
1164249642 19:23465805-23465827 AGAAGGAGGAGAGGAGGAAAAGG - Intergenic
1164249688 19:23466056-23466078 AGAAGGAGAGGAGGAGGAAATGG - Intergenic
1164250173 19:23468944-23468966 AGGAGTAGAGGAGGAGGAGAAGG - Intergenic
1164292508 19:23880669-23880691 AGGAGTAGAGAAGGAGGACAAGG + Intergenic
1164581645 19:29438749-29438771 AGAAGGAGGGGAGAAGGGGAGGG + Intergenic
1165207791 19:34205686-34205708 AAAAGTTGGTGAGGACGCCAGGG + Intronic
1165253407 19:34558185-34558207 AGATGTAGTTGAGGAGGCAAGGG + Intergenic
1165283705 19:34819503-34819525 AGAGGTAAGGGAAGAGGCAAGGG + Intergenic
1165359772 19:35329113-35329135 AGAAGCAGGGGGTGTGGCCATGG + Intronic
1165786261 19:38463653-38463675 AGAACTAGGGTTGGAGGTCAGGG + Intronic
1165815983 19:38642506-38642528 AGAGGAAGGGGACGAGGCCCAGG - Intergenic
1165916481 19:39264227-39264249 AGAAGTGAGGGCAGAGGCCAAGG + Intergenic
1166337434 19:42116856-42116878 GGAAGTAGAGGAGGAGGCGGAGG + Intronic
1166552065 19:43672401-43672423 AGAAGTAGGGCAGATGGGCAGGG + Intergenic
1166661141 19:44647873-44647895 GGAAGGAAGGGAGGAGGCCTGGG + Intronic
1166852045 19:45765779-45765801 GGAAGTTGGGCAGGAGGCCAGGG + Exonic
1166855900 19:45782513-45782535 GGGAGAAGGGGAGGAGGCCTCGG - Intronic
1167130499 19:47582196-47582218 AGGAGGAGGGGAGGAGGAAAAGG - Intergenic
1167650954 19:50728347-50728369 AGAACAAGGGCAGGAGGCCTGGG + Intergenic
1168268380 19:55236079-55236101 AGTACTTCGGGAGGAGGCCAAGG - Intronic
1168327327 19:55545000-55545022 AGTGGTGGGGGAGGAGGTCACGG + Intronic
1202646241 1_KI270706v1_random:144647-144669 AGAAGTAGGGAAGGAGGCCAGGG - Intergenic
925120830 2:1416846-1416868 AGAGGCTGGGGAGCAGGCCAAGG - Intronic
925649505 2:6074173-6074195 AGAGGTAGGGGAGGAGAGAAAGG + Intergenic
925923501 2:8654043-8654065 AGAAGTTGGGAGGGAGGACACGG - Intergenic
926034918 2:9629066-9629088 GGGGGTGGGGGAGGAGGCCAGGG + Intronic
926231901 2:11010652-11010674 TGAAGAAGGAGACGAGGCCATGG + Intergenic
926365612 2:12130216-12130238 AGAAAAAGAAGAGGAGGCCAAGG - Intergenic
926619478 2:15034083-15034105 AGAAGAAGAGGAGGAGGAGAAGG + Intergenic
926813938 2:16781764-16781786 AAAAGCAGGGGAAGAGGCGAAGG - Intergenic
927287273 2:21369837-21369859 GGAAGAAGGGGAGGAGGTAATGG - Intergenic
927867304 2:26598418-26598440 AGAGGCACGGGAGGGGGCCACGG + Intronic
927879404 2:26679999-26680021 AGCAGGAGGGGAGGAGGAGAAGG + Intergenic
928305852 2:30169870-30169892 AGCACTTTGGGAGGAGGCCAAGG - Intergenic
928453756 2:31401066-31401088 AGGAGATGGGGAGGTGGCCAGGG + Intronic
928694558 2:33836215-33836237 AGGAGTAGGGGAAGAGGGCAGGG + Intergenic
928723392 2:34145511-34145533 AGAATTAGGAGAGGAATCCAAGG - Intergenic
929778890 2:44944786-44944808 AGGAGTGGGGGAGGAGGGGAAGG - Exonic
929855454 2:45634976-45634998 AGAATTTGGGGAGGAGGTAATGG + Intergenic
930322038 2:49867726-49867748 AGAATTAGGAGTGGAGCCCAAGG - Intergenic
930517360 2:52424723-52424745 AAAAGAAGAGGAGGAGGGCAAGG + Intergenic
931654658 2:64500200-64500222 GGAAGTAGGGGAGGTGGGCGAGG + Intergenic
932586028 2:73029600-73029622 AGACCTAGGTGAGGAGGCCTGGG - Intronic
932598896 2:73111084-73111106 GGAAGGCGGGGAGCAGGCCAGGG + Intronic
932857515 2:75252363-75252385 AGTACTAGGGAAGGGGGCCAAGG - Intergenic
933337463 2:80976370-80976392 AGAAGTAGGGGAGAAGGAAGAGG + Intergenic
933526716 2:83450169-83450191 AGAAATATGAGAGGTGGCCATGG + Intergenic
933645588 2:84810433-84810455 AGCATAAGGGGAGGAGCCCAGGG + Intronic
933766453 2:85712536-85712558 AGAAGTGGAGGATGGGGCCACGG + Intergenic
934509379 2:94925074-94925096 GAAGGTAGGGGAGGAGGCCAGGG - Intergenic
934604045 2:95680911-95680933 CCAAGTAGGGAAGGGGGCCAGGG + Intergenic
934655461 2:96114916-96114938 AGAAGAACTGGAAGAGGCCATGG + Exonic
935312829 2:101802444-101802466 AGAAGGAGGAGAGGAGGGCTGGG - Intronic
935398496 2:102636223-102636245 AGAAGTCAGGGAGGAGGGAAAGG + Intronic
935470563 2:103454815-103454837 TAAAGTAGGGGAGGAAGTCATGG - Intergenic
935755532 2:106273542-106273564 AGAAGGTGGTGAGGAGGCCTGGG - Intergenic
936502489 2:113077403-113077425 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
936559080 2:113520777-113520799 AGAACTAAGGCAGGAGGCCAAGG + Intergenic
937472883 2:122188870-122188892 AGAAGTGGGGGTGGAGGTGAGGG + Intergenic
937713900 2:125010241-125010263 GGAATTAGGGGAGGAGGACTGGG + Intergenic
937784403 2:125878287-125878309 AGAAAATGGGGAGGAGGCTAGGG + Intergenic
937988463 2:127649313-127649335 AGCAGGAGGGGAGGAGGCACGGG - Intronic
938367608 2:130747226-130747248 AGAAGTCTGGGAGGAGGCATTGG + Intergenic
938776484 2:134545615-134545637 AGAATTTGGGGAGGAGGTGAAGG - Intronic
940028347 2:149232956-149232978 GGAAGTGTGGGAGGAGGCAATGG + Intergenic
940414989 2:153409130-153409152 AAAAGTAGGGAAGCAGGCAATGG - Intergenic
940517595 2:154699554-154699576 AGAACCAGGGGAGGGGGCCCGGG - Intronic
941465193 2:165817255-165817277 AGAAGGAAGGAAGGAGGACAAGG + Intergenic
941692871 2:168519511-168519533 GGAAGGTGGGGAGGAGGGCAAGG - Intronic
942496034 2:176541059-176541081 AGGAGGAGGGGAGGAGGGGAGGG + Intergenic
942496058 2:176541103-176541125 AGGAGGAGGGGAGGAGGGGAGGG + Intergenic
942777583 2:179602444-179602466 AGCACTTTGGGAGGAGGCCAAGG - Intronic
942831365 2:180239965-180239987 AGAAGTGGGGGAAGAGAGCAAGG + Intergenic
942910747 2:181241544-181241566 AGAGGGAGGGAGGGAGGCCAAGG - Intergenic
944360503 2:198850056-198850078 GGAAGAACGGGAGGAGGGCAAGG + Intergenic
944966850 2:204944820-204944842 AAAAGAAAGGGAGAAGGCCATGG - Intronic
945273480 2:207964545-207964567 AGAATTAGGGGTGGAGGGGAAGG + Intronic
945288610 2:208106691-208106713 AGGAGTAGGGAAGCAAGCCAGGG - Intergenic
945997194 2:216447592-216447614 AGAAGTAGGTGAGGGGGTAAGGG + Intronic
946169827 2:217888287-217888309 AGATGGAGGAGAGGAGGGCAGGG - Intronic
946249558 2:218404341-218404363 CGAAGAAGGGGAGGAGGTCGTGG - Exonic
946359514 2:219210682-219210704 GGAAGGAGGGGAGGAGACCCAGG + Intronic
946432155 2:219631661-219631683 AGAAGGAGGGGCAGTGGCCATGG + Intronic
947586940 2:231362166-231362188 AGAAAGAGGGGAGGAGGCCCAGG - Intronic
947600036 2:231441518-231441540 AGCACTTGGGGAGGAGGCCGAGG - Intergenic
948271841 2:236680342-236680364 GGAAAAAGGGGAGAAGGCCAGGG + Intergenic
948483328 2:238264027-238264049 AGAAGGAGGGGAGGAGGAGGGGG + Intronic
948735884 2:240004600-240004622 AGGACTAGGAGAGGAGGCCATGG - Intronic
948815876 2:240510161-240510183 AGGACTGGGGGAGGAGGGCAGGG - Intronic
948945367 2:241216545-241216567 AGAATTAGGAGAGCAGGCCCTGG + Intronic
1168842242 20:916912-916934 AGAGGGAGGGGAGGAGGCAGAGG + Intergenic
1169273442 20:4217695-4217717 AGAAGGCGGGGAGGAGACCAGGG + Intergenic
1169468059 20:5858930-5858952 AGAAGAAAAGGAGGAGGGCAGGG - Intronic
1170111626 20:12809911-12809933 AGAAGAAGAGGAGGAGGAGAAGG + Intergenic
1170231515 20:14051942-14051964 AGAAGTGGTGGAGGATGGCATGG + Intronic
1170810686 20:19671900-19671922 TGAAGGAGTGGAGGAGGCAAAGG + Intronic
1170939078 20:20833687-20833709 AGGAATAGGAGAGGAGGCCTAGG + Intergenic
1171128364 20:22624665-22624687 GGAAGTAGGGAGGGAGGGCAGGG - Intergenic
1171236954 20:23535048-23535070 AGAAGCACGGAGGGAGGCCAAGG - Intergenic
1172826785 20:37795216-37795238 AGAGGTAGAGGAGGAGGCAGAGG - Intronic
1173077765 20:39836106-39836128 AGAAGAGAGGGAGGAGGACAAGG - Intergenic
1173406195 20:42767373-42767395 AGCAGTCAGGGAGGAGGCAAAGG - Intronic
1173667738 20:44774809-44774831 ACAAATGGGGGAGGAGGTCATGG - Intronic
1173865325 20:46308936-46308958 AGGAGCAGGGGCGCAGGCCAGGG + Intergenic
1174055879 20:47798104-47798126 AGCACTTTGGGAGGAGGCCAAGG + Intergenic
1174071773 20:47904760-47904782 TGAAGTGGGGGTGGAGGCCCAGG + Intergenic
1174110118 20:48193205-48193227 GGCAGGAGGGGATGAGGCCAGGG - Intergenic
1174120953 20:48265100-48265122 GGAAACAGGTGAGGAGGCCAGGG + Intergenic
1174292446 20:49518889-49518911 AGAGGTAGGGGAGGGGGCCACGG - Intronic
1174356006 20:49998279-49998301 AGCAGTTGAGGAGGTGGCCACGG + Intergenic
1174393233 20:50231072-50231094 AGCACTGTGGGAGGAGGCCAAGG - Intergenic
1174566223 20:51466351-51466373 AGAATTAGGGAGGGAGGCCCGGG - Intronic
1174709500 20:52690017-52690039 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
1175115554 20:56679397-56679419 TGGAGGAGGGGAGGATGCCAGGG + Intergenic
1175359256 20:58395032-58395054 AAAATTAGGGGAGGAGTCAAGGG + Intronic
1175369202 20:58475854-58475876 ACAAGTAGGGATGAAGGCCATGG - Intronic
1175420456 20:58829113-58829135 AGAAGCAGGGAAAGAGGCCCAGG - Intergenic
1175674567 20:60935636-60935658 AGAAGGAGGAGAGGAGGGAAGGG - Intergenic
1175954965 20:62604555-62604577 AGACCTTGGGGAGGAGGCCTGGG - Intergenic
1176416555 21:6478840-6478862 AAAGGTTGGGGAGGACGCCAGGG - Intergenic
1176605633 21:8828114-8828136 AGAAGTAGGGAAGGAGGCCAGGG + Intergenic
1176717371 21:10364503-10364525 AAAAGGAGGGGAGGAGACCACGG + Intergenic
1176801626 21:13435976-13435998 AGAAGCAGGGGAGGAGGCCAGGG - Intergenic
1177794788 21:25762952-25762974 AAAAGTAGTGGAGGCGGCGAAGG - Intronic
1178346621 21:31834078-31834100 AGAAGTGGGTGAGGAGGTGATGG + Intergenic
1178361602 21:31953073-31953095 AGAAGTATGTGAGGATACCAAGG - Intronic
1178379163 21:32093666-32093688 AGATGAAGGGGAAGAGGACATGG - Intergenic
1178850654 21:36209599-36209621 AGAGGAGGGGGAGGACGCCAAGG - Intronic
1178952877 21:36999518-36999540 TGAAGCAGGGAAGGAGGCTAGGG + Intergenic
1179117473 21:38507296-38507318 AGCAGTTGGGGATGAAGCCAAGG - Intronic
1179311222 21:40197925-40197947 TATAGTAGCGGAGGAGGCCAAGG + Intronic
1179600760 21:42476018-42476040 AGAACCCGGGGAGGAGGCCCAGG - Exonic
1179692055 21:43087175-43087197 AAAGGTTGGGGAGGACGCCAGGG - Intergenic
1179891638 21:44338688-44338710 TGAGGGAGGGGAGGAGGCCGGGG - Intronic
1180078759 21:45476443-45476465 AGAAGTCGAGGAGCAGACCACGG + Exonic
1180298595 22:11017423-11017445 AAAAGGAGGGGAGGAGACCACGG + Intergenic
1180347930 22:11719718-11719740 AGAAGTAGGGAAGGAGGCCAGGG + Intergenic
1180355708 22:11837820-11837842 AGAAGTAGGGAAGGAGGCCAGGG + Intergenic
1180382545 22:12154505-12154527 AGAAGTAGGGAAGGAGGCCAGGG - Intergenic
1180600971 22:17015490-17015512 AAAAGGAGGGGAGGAGACCACGG - Intergenic
1182089894 22:27587117-27587139 GGAAGCAGTGGAGGAAGCCAAGG + Intergenic
1182374073 22:29833417-29833439 AGAAGAAGGGAAGAAGGACATGG + Intronic
1182501782 22:30753312-30753334 AGATGGAGGTGAGGAGGGCAGGG + Intronic
1182751390 22:32644764-32644786 AGGAATGAGGGAGGAGGCCACGG - Intronic
1183227647 22:36561460-36561482 AGAAGTACAGGGGGAGGTCATGG - Intergenic
1183477734 22:38045160-38045182 AGCAGTGAGGGAGGAGGCTAAGG - Intergenic
1183627947 22:39016172-39016194 ATAATGTGGGGAGGAGGCCAGGG - Intronic
1184453191 22:44594896-44594918 AGCAGGAGTGGAGGGGGCCATGG + Intergenic
1184567390 22:45300287-45300309 AGAAGTGGGGGTGGAGGGCCAGG - Intergenic
1184837631 22:47033377-47033399 AGAAGTAGAGGAGGACGGCCAGG + Intronic
1185030377 22:48439831-48439853 AGAGGTGGCTGAGGAGGCCAAGG + Intergenic
1185109047 22:48890634-48890656 AGAAGAGGAGGAGGAGGCCTTGG + Intergenic
1185234444 22:49704042-49704064 AGAAGAAGGGGTGCAGCCCAGGG + Intergenic
1185398335 22:50603749-50603771 GGAAGCGGGGGAGGAGGGCAGGG + Intronic
950032202 3:9860631-9860653 GGAGGTGGGGGAGGGGGCCAGGG - Intergenic
950116129 3:10451214-10451236 AGGGGAAGGGGAGGAGCCCAGGG - Intronic
950270212 3:11608619-11608641 AGAAAGAGGGGAGGAGAACAGGG + Intronic
950284229 3:11732278-11732300 AGAAGAAAGGGAGGAAGGCAGGG - Intergenic
950415347 3:12866154-12866176 GGAGGTGGGGGAGGGGGCCAGGG - Intronic
950423181 3:12910578-12910600 AGGAGGTGGGGAGGCGGCCAGGG + Intronic
951170729 3:19539079-19539101 AGAAGTTGGGGAAGAGGAGAGGG - Intergenic
951595285 3:24312104-24312126 GGAAGTAGGGCAGAAGGCAAGGG - Intronic
952321569 3:32282740-32282762 AGAGGTAAGGGAGGAACCCATGG - Intronic
952414291 3:33076331-33076353 TGAGGCAGAGGAGGAGGCCAGGG + Intronic
952584379 3:34873276-34873298 AGCAGTGGGTGAGGAGGCAATGG - Intergenic
952741433 3:36738360-36738382 AGAAGTGGGGGAGGGGGAAATGG - Exonic
953584247 3:44185460-44185482 AGTAGTAGGAGATGAGACCAGGG - Intergenic
954213485 3:49111455-49111477 AGAAGCTGGGGAGGAGGATAAGG - Intronic
954458941 3:50615475-50615497 AGGACTAGGAGAGGAGGCCATGG + Intronic
954551224 3:51483186-51483208 AGCACTTTGGGAGGAGGCCAAGG + Intronic
954688209 3:52382065-52382087 ATTACTAGGGGAGGTGGCCAGGG + Intronic
954698927 3:52441712-52441734 AGAGTCAGGGGAGGAGGCCCAGG + Intronic
955142600 3:56284545-56284567 AGAAGCAGGGGAGGAGGAAGAGG + Intronic
955366575 3:58315374-58315396 AGGAGTAGGGGAGGAGGGGTGGG + Intronic
955741544 3:62096087-62096109 AGAAGTAGGGGAGGACACATGGG + Intronic
955790749 3:62586484-62586506 AGAGGAGGAGGAGGAGGCCATGG + Intronic
955834431 3:63039156-63039178 AGAAGAAGGGGGAGAGGACAGGG - Intergenic
956037763 3:65113742-65113764 AGAAGAATGGGAGGAAGACATGG + Intergenic
956184952 3:66553520-66553542 CGAATGAGGGAAGGAGGCCAGGG + Intergenic
956440929 3:69279759-69279781 AGGAGGAGGGGAGGAGGAGAAGG - Intronic
957400063 3:79699972-79699994 AGAAGGGAGGGAGGAGGACAAGG - Intronic
957804209 3:85125608-85125630 AGCACTTTGGGAGGAGGCCAGGG - Intronic
958438754 3:94130215-94130237 TGAAGTGGGGGTGGGGGCCAAGG + Intergenic
958603045 3:96323628-96323650 AGAAGAAGAGGAGGAGGAGAAGG + Intergenic
959095699 3:101952969-101952991 AAAAGAAGGGCTGGAGGCCAGGG + Intergenic
959684388 3:109128997-109129019 ACAATCATGGGAGGAGGCCAAGG + Intergenic
959718457 3:109459839-109459861 GGAATTAGGGAAGGACGCCAAGG - Intergenic
961035266 3:123637695-123637717 AGAAGGAGGGCAGGAGGCCAGGG - Intronic
961039971 3:123671374-123671396 TGAAAGAGGGGCGGAGGCCAGGG + Intronic
961153266 3:124657815-124657837 AGGAGTTGGGGAGGAGGTGATGG - Intronic
961232767 3:125333643-125333665 TGAAGTGGGGGAGTAGGGCAAGG - Intronic
961250583 3:125501367-125501389 AGCACTTTGGGAGGAGGCCAAGG + Intronic
961333464 3:126156485-126156507 AGCAGGAGGGAAGGAGGCCCTGG - Intronic
961349814 3:126292677-126292699 AGCAGTGGGGGAGGTGTCCATGG + Intergenic
961477278 3:127156791-127156813 GGAAGTGGGGAAGGAGGACAAGG - Intergenic
961658984 3:128458369-128458391 AGAGGGAAGGGAGGAGGCCAGGG + Intergenic
962164152 3:133031599-133031621 AGAAGTAGTTAAGAAGGCCAAGG + Intergenic
962850760 3:139306795-139306817 ACCAGCAGGGGAGGGGGCCAGGG + Intronic
963090482 3:141478998-141479020 AGAAGAAGGGGAGGAGGAGGAGG + Intergenic
963134082 3:141884666-141884688 AGATGTAGGCTAGGAGGCTAGGG - Intronic
963474179 3:145782224-145782246 GGAAGAAGGGGAGGAGGAGAAGG + Intergenic
963476527 3:145812130-145812152 AGCACTTTGGGAGGAGGCCAAGG + Intergenic
963848142 3:150180986-150181008 AAAAGTGGGGCAGCAGGCCACGG + Intergenic
964110661 3:153083882-153083904 TGAAGTGGGGGAGGAGGAAAAGG + Intergenic
966521917 3:180882430-180882452 AGAAGAAGAGGAGGAGGAGAAGG - Intronic
967054225 3:185814190-185814212 AGAAGGAAGGGAGGAGGGAAAGG - Intronic
967118249 3:186361211-186361233 AGAATTAGGGGAGGGGGCTGTGG - Intronic
967216940 3:187218991-187219013 CCAAGAAGGGAAGGAGGCCAGGG + Intronic
967767507 3:193297236-193297258 AGCAGTAGACGAGAAGGCCATGG - Intronic
968368218 3:198203682-198203704 CGAAGTCAGCGAGGAGGCCAGGG + Intergenic
969032317 4:4225228-4225250 AGGTGAAAGGGAGGAGGCCATGG - Intronic
969285244 4:6198966-6198988 AGGAGGTGGGGAGGAGGGCAGGG - Intronic
969334967 4:6502452-6502474 GGAAGAAGGGAAGGAGGGCAGGG - Intronic
969702366 4:8774475-8774497 AGAAGTGCTGGACGAGGCCAGGG - Intergenic
971405321 4:26317429-26317451 AGAGGTAGAGGAGGAGGTGAAGG + Intronic
971516591 4:27494623-27494645 AGAAGAAGAGGAGGAGGAGAAGG + Intergenic
972013900 4:34219915-34219937 GGAAGTATGGGAGGGGGGCAAGG + Intergenic
972032388 4:34477793-34477815 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
972153674 4:36129307-36129329 AGAAGCCTGGGAGGAGGCAAGGG - Intronic
972228265 4:37040150-37040172 AGAAGATTGGGAGGAGGTCAGGG + Intergenic
972318369 4:37948769-37948791 AGAAGTAAGGGAGGAAGACGGGG - Intronic
973303593 4:48617664-48617686 ACAAGGAGGGGAAGAGGACAGGG + Intronic
973372477 4:49262875-49262897 AGAAGTAGGGAAGGAGGCCAGGG - Intergenic
973388526 4:49532266-49532288 AGAAGTAGGGAAGGAGGCCAGGG + Intergenic
975190310 4:71452765-71452787 GGAACTAAGGGAGGAAGCCATGG - Intronic
975362340 4:73485647-73485669 AGAAGAAGGGGAGGAGGAGGAGG + Intronic
975431363 4:74295187-74295209 AGAAGAAAGAGAGGAGGCCGGGG - Intronic
975892906 4:79050439-79050461 AGAAGGAGGAGAGCAAGCCAGGG - Intergenic
976621023 4:87127483-87127505 ATAAGGAGGGGAGGAGGAAATGG - Intronic
977247525 4:94650779-94650801 AAAGGTAGGGAAGGATGCCAAGG - Intronic
977814389 4:101397546-101397568 TAAAGAAGGGGAGGAGGCCTAGG + Intergenic
977819909 4:101459031-101459053 AGCAGTAGTGGTGGTGGCCAAGG - Intronic
978147668 4:105395111-105395133 AGAAAAAAGGGAGAAGGCCAAGG + Intronic
979258150 4:118625449-118625471 AGAATTGGGGGAGGGAGCCAGGG + Intergenic
979258207 4:118625752-118625774 AGAACTAGGGGAGGAGGCCAGGG + Intergenic
979330142 4:119414816-119414838 AGAACTAGGGGAGGAGGCCAGGG - Intergenic
979330197 4:119415119-119415141 AGAATTAGGGGAGGGAGCCAGGG - Intergenic
979436694 4:120701673-120701695 AGAAGGAGGGGAGGAGATAAGGG + Intronic
979674936 4:123399420-123399442 AGGAGGAGGGGAGGAGGCTGAGG - Intronic
980222567 4:129938600-129938622 AGAAAAAGGGGAGGAGGAGAAGG - Intergenic
981044536 4:140253079-140253101 AGGAGGAGGGGAAGAGGCCGAGG + Intergenic
981233025 4:142380679-142380701 AGAAGTAGATGAGGAGGTGAGGG - Intronic
981254393 4:142644272-142644294 AGGAGTGGGGGAGGAGGAGAAGG + Intronic
981914529 4:150019237-150019259 AGAAGTAAGTGAGAAGGTCATGG + Intergenic
982136643 4:152279291-152279313 AGACGGAAGGGAGGAGGCCCTGG - Intergenic
983177619 4:164610086-164610108 AGAAGTAAGGGAGAAACCCAAGG + Intergenic
983522684 4:168726866-168726888 AGAAGAAAGGGAGGAGGCTGTGG - Intronic
983532649 4:168827278-168827300 ACTAGTAGGGGAGGAGGGAAAGG - Intronic
983759256 4:171384963-171384985 AGAAGAGGGGGAGGAGGAAAAGG - Intergenic
984402065 4:179279009-179279031 AGAAAGAGGAGAGGAGGCAAGGG - Intergenic
984742096 4:183174765-183174787 AGAAGGAGGAGAGGAGGAAAAGG - Intronic
985632635 5:1021975-1021997 GGAAACAGGGAAGGAGGCCAGGG - Intronic
985694937 5:1334954-1334976 AGCAGGAGGCGAGGAGGCCCCGG + Intronic
986362423 5:6993176-6993198 AGAAGACGGGGAGGAGGGGATGG - Intergenic
986400681 5:7376527-7376549 ACAGGCAAGGGAGGAGGCCATGG - Intergenic
986402284 5:7394250-7394272 AGGAGTGGAGGAGGAGGCAATGG - Intergenic
986736852 5:10674388-10674410 AGGAGATGGAGAGGAGGCCAGGG - Intergenic
986763089 5:10897749-10897771 AGAAGTAAGGGCTGAAGCCACGG + Intergenic
987039207 5:14046133-14046155 AGAAGTAGGGCAGGTGGAGAGGG - Intergenic
987046375 5:14113060-14113082 AGAAGTTGGGTTGTAGGCCAGGG - Intergenic
988395512 5:30692929-30692951 AGAGGCAGGGAAGGTGGCCATGG + Intergenic
988486565 5:31672510-31672532 ACAAGTGGGGCAGGAGGCCCTGG - Intronic
988589189 5:32534315-32534337 AGAAATAGGGGAGGAGATGATGG - Intronic
988865021 5:35324866-35324888 AGGAGTAGGGCAGGGGGGCAGGG - Intergenic
989166019 5:38434232-38434254 GGGAGTAGGGGAGGTGGTCAAGG - Intronic
989214061 5:38885347-38885369 AGAAGTACTTGAGGAGCCCAAGG + Exonic
989370456 5:40701517-40701539 AGAAGTAGGGGATTATGCAAAGG + Intergenic
991254720 5:64601452-64601474 AGAAGAAAGGAAGGTGGCCAAGG + Intronic
991329871 5:65482545-65482567 AAAAGTAGGGGAGGAGGGAGCGG + Intergenic
991366821 5:65877183-65877205 AGAAGAAGAGGAGGAGGAGAAGG - Intergenic
991943202 5:71875073-71875095 AGAAATAGGAGAGGCTGCCAGGG - Intergenic
992090654 5:73313002-73313024 AGAAGAAGAGGAGGAGGAGAGGG - Intergenic
992856689 5:80868930-80868952 AGAAGTTGGGGAAGAGGTAATGG - Intronic
993379597 5:87191376-87191398 AAAAGCAGGGAAGGAGGACAGGG + Intergenic
993396737 5:87398721-87398743 AGAAGTATGCCGGGAGGCCAAGG + Intronic
993644815 5:90449501-90449523 AGAAGAAGAGGAGGAGGCAGAGG - Intergenic
993706253 5:91174536-91174558 AGGAGAAGGGGTGGAGGCTAAGG - Intergenic
993828186 5:92719927-92719949 AGAAGTAAGGGAGATGGCAAAGG - Intergenic
995100031 5:108289479-108289501 AAAAGTAGAGGAGGAGATCAGGG - Intronic
995264858 5:110146877-110146899 AGTAATAGGGGAGGAGGGCTAGG + Intergenic
997167377 5:131675718-131675740 AGAAGTTGGGGAGAAGGAGATGG + Intronic
998139323 5:139690891-139690913 AGAAGTAGGCAGGGAGGCAAGGG - Intergenic
998208503 5:140175976-140175998 AGAAGGAGGGGAGGACCCCTGGG + Intronic
999145718 5:149391952-149391974 AGAAGCTGGGGAAGAGGGCAGGG - Intronic
999410320 5:151344678-151344700 AGAAGTAGGGGTGAAGAACAGGG - Intronic
999741812 5:154561333-154561355 AGCACTTTGGGAGGAGGCCAAGG + Intergenic
1000414465 5:160968840-160968862 AGAAGTTTGGAAGGAGGCAACGG + Intergenic
1000913018 5:167045125-167045147 AGAAGAAGAGGAGGATACCATGG + Intergenic
1001927141 5:175646054-175646076 TGAAGTAGGGGAGGACCACATGG + Intergenic
1001977786 5:176014362-176014384 GGAAGAAGGGCAGGAGGCCTAGG + Intronic
1002191067 5:177477968-177477990 GGAAGGAGGGGAGGGGACCAGGG - Intergenic
1002239633 5:177829400-177829422 GGAAGGAGGGCAGGAGGCCTAGG - Intergenic
1002329481 5:178431565-178431587 AGAAGTAGGCGATGTGGCCATGG + Intronic
1002727439 5:181308913-181308935 CGAAGTCAGCGAGGAGGCCAGGG + Intergenic
1002844893 6:937380-937402 AGAAGGAGAGGAGGAAGACAAGG - Intergenic
1003195698 6:3912214-3912236 AAAAATAGTGTAGGAGGCCAGGG + Intergenic
1003405136 6:5821639-5821661 AGAAGGAGGGGAGGAAGAAATGG - Intergenic
1004262317 6:14118609-14118631 AGGGCTAGGGGAGGAAGCCAAGG - Intronic
1004280848 6:14278467-14278489 CGAAGAAGGGGAGGAGGAGATGG + Intergenic
1005090734 6:22054258-22054280 AGCACTTTGGGAGGAGGCCAAGG - Intergenic
1006116629 6:31779263-31779285 GGAAGTGGCGGATGAGGCCACGG - Exonic
1007425772 6:41745038-41745060 AGAAAGAGGGGAAGAGGCAAAGG - Intronic
1007641093 6:43340313-43340335 AGAAGTAAAGGAGGATGACAAGG - Exonic
1007989765 6:46243116-46243138 CGATGTGGGGGAGGATGCCATGG + Intronic
1008531033 6:52459072-52459094 AGAAGTAAGGGAGAGGGACAAGG + Intronic
1008969792 6:57354192-57354214 AGAAGTAGGGAAGGAAGGAAGGG - Intronic
1009037813 6:58139180-58139202 AGCAGCAAGGGAGGAGGGCAGGG - Intergenic
1009158757 6:60256018-60256040 AGAAGTAGGGAAGGAAGGAAGGG - Intergenic
1009213599 6:60892817-60892839 AGCAGCAAGGGAGGAGGGCAGGG - Intergenic
1011165708 6:84443588-84443610 AGAGTAAGGGGAGTAGGCCAAGG + Intergenic
1012182712 6:96175261-96175283 AGAAGCAGGTGACGGGGCCATGG - Intronic
1012515811 6:100057708-100057730 AGAAGGAAGGGAGGAAGGCAGGG - Intergenic
1013233606 6:108177290-108177312 AGAAGTAGGTGAGGGGAGCATGG - Intronic
1013505245 6:110793754-110793776 GGAAGAAGGGGAAGAGGCAAAGG - Intronic
1013626437 6:111941932-111941954 AGATGTAGGGGAGGAGGCGATGG - Intergenic
1014271386 6:119340383-119340405 AGAAATAGGACAGGAGGCCAGGG - Intronic
1014679988 6:124416394-124416416 AGCACTTTGGGAGGAGGCCAAGG + Intronic
1015042553 6:128739759-128739781 GGAAGTGGGGGAGGAAGCGAGGG - Intergenic
1015537081 6:134277124-134277146 AGCACTTTGGGAGGAGGCCAAGG + Intronic
1016438433 6:144060776-144060798 AGAGGTCGGGGAGGGGACCATGG - Intronic
1016728465 6:147401955-147401977 AAAATTATGGCAGGAGGCCAAGG + Intergenic
1017424924 6:154310378-154310400 AGAGGAAGGGGAGGAGGTCTAGG + Intronic
1017810734 6:157981805-157981827 GGAGGAAGGGGAGGAGGCCGGGG + Intergenic
1018101687 6:160446080-160446102 AGAAGGAGAGGAGGTGGCCAAGG + Intronic
1018142562 6:160853808-160853830 AGAAGACGGTGAGGAAGCCAGGG - Intergenic
1018675142 6:166214303-166214325 AGAAGTAGAGGAGGAGGAAGAGG + Intergenic
1018911610 6:168103819-168103841 AGAGGAAGAGGAGGAGGACAAGG + Intergenic
1018991283 6:168676073-168676095 AAGAGGTGGGGAGGAGGCCAGGG - Intergenic
1019287319 7:230201-230223 AAACGCAGAGGAGGAGGCCAAGG + Intronic
1019551803 7:1606844-1606866 AGGAGGAGGGGAGGAGGGAAGGG - Intergenic
1020026810 7:4905337-4905359 AGAAGAAGAGGAGGAGGAGAAGG + Intergenic
1020246955 7:6436897-6436919 AGCACTTTGGGAGGAGGCCAAGG + Intronic
1021042272 7:15876909-15876931 AGCAGTAGGAGATGAGGTCAAGG + Intergenic
1021485939 7:21168589-21168611 AGAAGCAGGAGTGAAGGCCATGG + Intergenic
1021692089 7:23240554-23240576 TGAAGTAGGTGAGGAGTACATGG + Intronic
1022142950 7:27509097-27509119 CTCAGCAGGGGAGGAGGCCAAGG - Intergenic
1022500130 7:30877558-30877580 TGGAGGAGGAGAGGAGGCCAGGG - Intronic
1022560149 7:31339073-31339095 AGAAGAAGAGGAGGAAGACAGGG - Exonic
1022845781 7:34208436-34208458 GAAGGTAGGGGAGGAGGACAAGG - Intergenic
1023345498 7:39267184-39267206 AGAACTACGGGAGGAGGCTGTGG + Intronic
1023398621 7:39774701-39774723 CGAAGTCGGCAAGGAGGCCAGGG + Intergenic
1023400135 7:39786742-39786764 AGAATTAGGGGAGGGGGCCAGGG + Intergenic
1023400192 7:39787046-39787068 AGAAGTAGGGGAGGAGGCCAGGG + Intergenic
1023423747 7:40012346-40012368 AGCACTTTGGGAGGAGGCCAAGG + Intronic
1023591359 7:41783777-41783799 AGAAGTAGGGGAATAGCCAACGG + Intergenic
1024073120 7:45802797-45802819 AGAAGTAGGGGAGGAGGCCAGGG + Intergenic
1024196480 7:47064075-47064097 AGAAGTAGAGGAGGAGGAGGTGG - Intergenic
1024196562 7:47064905-47064927 AGAAGTAGAGGAGGAGGAGGAGG - Intergenic
1024233111 7:47377789-47377811 TGAAGAGGGGGAGGAGGGCATGG - Intronic
1024650211 7:51397391-51397413 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
1024650269 7:51397695-51397717 AGAATTAGGGGAGGGGGCCAGGG - Intergenic
1024651816 7:51410004-51410026 CGAAGTCGGTGAGGAGGCCAGGG - Intergenic
1024787531 7:52925561-52925583 AGGAGCAGGGCAGGAGGCGATGG + Intergenic
1025054358 7:55753040-55753062 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
1025054413 7:55753345-55753367 AGAATTCGGGGAGGGGGCCAGGG - Intergenic
1025132408 7:56383193-56383215 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
1025132465 7:56383497-56383519 AGAATTAGGGGAGGGGGCCAGGG - Intergenic
1025134026 7:56395785-56395807 CGAAGTCGGTGAGGAGGCCAGGG - Intergenic
1025147360 7:56516322-56516344 AGAAGTAGGTGGGGAGGGCTGGG + Intergenic
1025183468 7:56837647-56837669 AGAAGTAGGGGAGGAGGCCAGGG - Intergenic
1025237112 7:57242057-57242079 AGCACTTTGGGAGGAGGCCAAGG - Intergenic
1025688457 7:63739320-63739342 AGAAGTAGGGGAGGAGGCCAGGG + Intergenic
1025909999 7:65820585-65820607 TGAAGCAGGCGAGGAGGCCAGGG + Intergenic
1025911525 7:65832531-65832553 AGAATTAGGGCAGGAGGCCAGGG + Intergenic
1025911569 7:65832815-65832837 AGAAGTAGGAGAGGAGGCCAGGG + Intergenic
1025978079 7:66385461-66385483 AGAAGTAGGGGAGGAGGCCAGGG - Intronic
1026044241 7:66894830-66894852 AGAAGTAAGGGAGCAGGCCAGGG + Intergenic
1026191853 7:68136208-68136230 AGAAGTAGAGGAGGAGGAGAAGG + Intergenic
1026191863 7:68136266-68136288 AGAAGTAGAGGAGGAGGAGAAGG + Intergenic
1026319015 7:69252788-69252810 AGAAGTAGGCGGGGAGGGCCGGG - Intergenic
1026384265 7:69830227-69830249 AGCAGTGTGGGAGGAGGCAAGGG + Intronic
1026876192 7:73880382-73880404 AGATGGAGAGCAGGAGGCCAGGG - Intergenic
1026878191 7:73891764-73891786 AGACAGAGGGGAGGAGGCCTAGG - Intergenic
1026905847 7:74062250-74062272 GTGAGCAGGGGAGGAGGCCAGGG - Intronic
1026996779 7:74622211-74622233 AGAAGTGGGGGCGGAGGGGAGGG + Intergenic
1027203660 7:76080125-76080147 AGAAGTTGGGGAGGAGGCCAGGG - Intergenic
1027902620 7:84136916-84136938 AGAAGAAGGGGAGGAAGGAAGGG + Intronic
1029193236 7:98786513-98786535 GGAAGTTGGGGAGGAGGCAAGGG - Intergenic
1029366305 7:100118816-100118838 AAAAGTCGGGGAGGAGATCAGGG - Intronic
1029493578 7:100885247-100885269 AGAAGAATGGGAGAAGCCCAAGG + Exonic
1029526987 7:101100741-101100763 AGAAGCAGGGAAGGACGCCGTGG - Intergenic
1029691247 7:102183472-102183494 GGGAGTTGGGGAGGAGCCCAAGG - Intronic
1029706088 7:102276787-102276809 GGCAGTAGGGGAGGAGGGAATGG + Intronic
1031084216 7:117286462-117286484 AGAAGGAGGTGAGGAGGAGAGGG - Intronic
1031997898 7:128244917-128244939 AGAAGGAAGGGAGGAGGAAAGGG + Intronic
1032015728 7:128379320-128379342 GGCAGGAGGGGAGAAGGCCAGGG - Intergenic
1032050450 7:128646187-128646209 AGAATTAGGGGAGGGGGCCAGGG + Intergenic
1032050507 7:128646491-128646513 AGAAGTAGGGGAGGAGGCCAGGG + Intergenic
1034083763 7:148304794-148304816 ACATGGAGGGGAGGAGGCCATGG - Intronic
1035043987 7:155952231-155952253 AGAAGCAGAGGAGGTGGGCAGGG - Intergenic
1035764151 8:2092188-2092210 AGGAGTAGGAGAGGAGCCCCGGG - Intronic
1036712672 8:11091598-11091620 AGGAATAGGGGAGGAGGCAGTGG + Intronic
1036975385 8:13405281-13405303 AGAAGGAGGGAGGGAGGCAAGGG - Intronic
1037387754 8:18361506-18361528 ATATGTAGGGGAGGGGGGCATGG + Intergenic
1037564416 8:20105614-20105636 AGATGTGGGGGAGGAGGCCATGG - Intergenic
1037583690 8:20261940-20261962 AGAAGGAGGGAAGGATGTCAGGG - Intronic
1037649442 8:20823235-20823257 AGAGGTCGGTGAGGAGGCTATGG - Intergenic
1037660534 8:20922551-20922573 AGAAGGAGGGGAGGTCGGCAGGG - Intergenic
1037868867 8:22472445-22472467 AGATGTAGGGGGGCAAGCCAGGG - Intronic
1038092536 8:24270164-24270186 AGCACTATGGGAGGATGCCAAGG - Intergenic
1038349473 8:26763058-26763080 AGAAGTAGAGGAGGAGGAGGAGG + Intronic
1038579114 8:28731850-28731872 AAAAGAAGGGGAGGAGGAAAAGG + Intronic
1038591942 8:28847206-28847228 AGAAACTGGGGATGAGGCCATGG + Intronic
1038963549 8:32548197-32548219 AGAGGGAGGGGGCGAGGCCAGGG + Intronic
1039412660 8:37368338-37368360 AAGAGAAGGGGAGGAGGCAAAGG + Intergenic
1039986319 8:42451258-42451280 GGAAGAAGAGGAGGAGGACAGGG + Intronic
1040365719 8:46713076-46713098 AGAAGAAGGGGAGGAGGAGGAGG - Intergenic
1040635747 8:49270862-49270884 AGGAGTAGGGGAGAACACCATGG - Intergenic
1040875620 8:52148689-52148711 GGAAGGAGGGGAGGAGGGGAGGG + Intronic
1041278402 8:56187198-56187220 CGCAGTAGGGAAGGAGACCAGGG - Intronic
1042624844 8:70746904-70746926 AGAAGACAGGGAGGAGGGCAAGG - Intronic
1043485547 8:80695491-80695513 AGAATCAGGGGAGGGGGCGAGGG - Intronic
1043815747 8:84799072-84799094 AGAAGTTGGGGAGCAAGGCAGGG + Intronic
1044703709 8:94987921-94987943 AGAGGTAGGGGAGAACGCTAGGG - Intronic
1045812382 8:106237948-106237970 AGGAGTAGGGGAGGAGGAGAAGG + Intergenic
1046179013 8:110618355-110618377 AGAAGAAGAGGAGAAGGACAAGG - Intergenic
1047320205 8:123772051-123772073 AGGAGTAGGAGGGGAGCCCAGGG + Intronic
1047614264 8:126550249-126550271 AGAAGTGGAGGAGGGAGCCAGGG - Intergenic
1047906999 8:129483129-129483151 AGAAGGAGGAGAGGAGGGAAGGG + Intergenic
1048269479 8:133017159-133017181 AGATGTAGAGGTGGAGGCCTAGG - Intronic
1048329944 8:133464614-133464636 AGTAGTCGGGGAGGCGGCCACGG + Intronic
1048369042 8:133761054-133761076 AGAAGCAGGAGAGGGGGCCACGG - Intergenic
1048918570 8:139207150-139207172 ACAAGTTGGGCAGGAAGCCAAGG + Intergenic
1048981365 8:139704582-139704604 AGCAGAAGGGGAGGGGGCCATGG + Intergenic
1049353532 8:142176816-142176838 AGAAGTCAGGGAGGAGCCCAGGG - Intergenic
1049620186 8:143594632-143594654 AGAAGTCAGGGAGGTGGGCAGGG + Intronic
1049631433 8:143660387-143660409 AGTAGTCTGGGAGGAGGCCAAGG - Intergenic
1049893772 9:95404-95426 AGAACTAAGGCAGGAGGCCAAGG - Intergenic
1051152783 9:14102268-14102290 AGAAATAAAGGAGGAGGACAGGG + Intronic
1051534539 9:18142134-18142156 AAAAGAAGGGGAAGAGGTCAGGG - Intergenic
1051780215 9:20681797-20681819 AGAAGGAGGGGGTGAGCCCATGG + Intronic
1052379317 9:27753065-27753087 ATAAGTTGGAGAGGTGGCCAGGG - Intergenic
1052437747 9:28450437-28450459 AGCAGTTTTGGAGGAGGCCAAGG + Intronic
1052862740 9:33447030-33447052 AGATGTAGGGGAGGGGGCGGAGG - Intronic
1052934135 9:34078911-34078933 AGCACTTTGGGAGGAGGCCAAGG + Intergenic
1053136614 9:35654726-35654748 AGGAGTATGGGAGGAGGGGATGG + Intergenic
1053150957 9:35742461-35742483 AGAAGTAGAGGAGGAAGAGATGG - Intronic
1053656053 9:40219191-40219213 GAAGGTAGGGGAGGAGGCCAGGG + Intergenic
1053734997 9:41095488-41095510 AGAACTAAGGCAGGAGGCCAAGG - Intergenic
1053906399 9:42848393-42848415 GAAGGTAGGGGAGGAGGCCAGGG + Intergenic
1054352418 9:64029220-64029242 AGAAGTAGGGAAGAAGGCCAGGG + Intergenic
1054368159 9:64365415-64365437 GAAGGTAGGGGAGGAGGCCAGGG + Intergenic
1054528561 9:66157104-66157126 GAAGGTAGGGGAGGAGGCCAGGG - Intergenic
1054675779 9:67855158-67855180 GAAGGTAGGGGAGGAGGCCAGGG + Intergenic
1054693385 9:68335909-68335931 AGAACTAAGGCAGGAGGCCAAGG + Intronic
1054850648 9:69843454-69843476 AGAAGTAGGAGGGGAGGGGAGGG - Intronic
1055183660 9:73422769-73422791 AGAGGGAGGGGAGGAGGCAGGGG + Intergenic
1056175714 9:84033401-84033423 AGAGGTAGGGGAGGTGGGGATGG - Intergenic
1056465778 9:86852985-86853007 GGAGGTAGGGAAGGAGGCCAGGG - Intergenic
1056513371 9:87327180-87327202 AGAAGAAGGGGAGGAGGAGGAGG + Intergenic
1056672535 9:88642754-88642776 ATAAGAAGAGGAGGAGGACAAGG - Intergenic
1056737934 9:89225736-89225758 AAAAGCAAGGGAGGAGGCCAGGG - Intergenic
1057372986 9:94490766-94490788 AGAAGTAGGGTAGGATGCCAGGG + Intergenic
1057508100 9:95653041-95653063 AGAAGTAAGGGATGAAGCCATGG + Intergenic
1057704357 9:97386913-97386935 AGATGTAGGGGATGGGTCCAGGG + Intergenic
1058319916 9:103615970-103615992 AGAAGGAGGAGGGGAGGCCTTGG + Intergenic
1058972408 9:110095704-110095726 ACAAGATGGGGAGGAGGCAATGG - Intronic
1059216862 9:112572738-112572760 AGAAGTGTGGGAAGAGGCCATGG + Intronic
1059653166 9:116334188-116334210 AGAAGGAAGGGAGAGGGCCAGGG - Intronic
1059854004 9:118375149-118375171 AGGAGTAGGGAGGGAGGCCAAGG - Intergenic
1060491103 9:124084899-124084921 AGAAGGAGGGGCTGAGGACAGGG + Intergenic
1060654073 9:125356612-125356634 AGCAATTTGGGAGGAGGCCAAGG - Intronic
1060934025 9:127505657-127505679 AGCAGCAGGGGAGGGGGCCTGGG + Exonic
1061264399 9:129496998-129497020 AGAAGAAAGGAAGGAGGCGAGGG + Intergenic
1061838099 9:133342391-133342413 AGGAGCAAGGGAGGAAGCCAGGG - Intronic
1062174438 9:135153163-135153185 AGAAGTGAGGATGGAGGCCATGG + Intergenic
1062752559 9:138266387-138266409 CGAAGTCAGCGAGGAGGCCAGGG + Intergenic
1203553026 Un_KI270743v1:180122-180144 AGAAGTAGGGAAGGAGGCCAGGG + Intergenic
1203575073 Un_KI270745v1:1162-1184 CGAAGTCAGCGAGGAGGCCAGGG + Intergenic
1185573763 X:1154351-1154373 GGAGGTAGGGGAGGAGGGGAGGG - Intergenic
1185630596 X:1513849-1513871 AGACACAGAGGAGGAGGCCATGG - Intronic
1185688245 X:1948201-1948223 AGGAGGAGGGGAGGAGGAGATGG + Intergenic
1185688534 X:2133740-2133762 AGGAGGAGGGGAGGAGGAGATGG + Intergenic
1185767590 X:2738201-2738223 AGAACAAGGGGAGGTGGACATGG + Exonic
1186574006 X:10746029-10746051 TTAAGTCTGGGAGGAGGCCAGGG + Intronic
1186984388 X:14996418-14996440 AGAAGTAGGGTAGGGGGCAGGGG - Intergenic
1187103503 X:16218621-16218643 AGAGGTAGTGGAGGGGGGCAGGG + Intergenic
1187853693 X:23616280-23616302 AGAAGTAGGGAAGCAGGGCAAGG + Intergenic
1189350662 X:40273328-40273350 AGAAGTTGGGGAGGAAACCATGG - Intergenic
1189427280 X:40912674-40912696 AGGACTAGGGGAGGAAGCCCAGG - Intergenic
1190988766 X:55523925-55523947 ATAAGTAGGGGAGGGGGTGACGG + Intergenic
1191864209 X:65690804-65690826 AGCAGTAGGGGCTGGGGCCAAGG - Intronic
1191916288 X:66205259-66205281 AGAAATTGGGGTGGAGGGCAAGG - Intronic
1192153104 X:68724158-68724180 AGAGGCAGGGGAGGGGGTCAAGG - Intronic
1192176341 X:68888094-68888116 AGATGTAGGGGAAGAGGGGAAGG - Intergenic
1192249675 X:69401417-69401439 AGAAGTGGGGGTGGGGGCAAAGG - Intergenic
1193274710 X:79571432-79571454 TAAAGTTGGGGAGGGGGCCAAGG - Intergenic
1194427663 X:93759951-93759973 AGAAGTAGGGGAGGATGAAGAGG - Intergenic
1196398546 X:115290609-115290631 AGAAATGGGGGAGGAGGGGAGGG + Intronic
1197546911 X:127837402-127837424 AGAATTATGGCAGGAGGCAAAGG + Intergenic
1197747292 X:129940179-129940201 GGAAGTAGGGGCGGGGCCCAGGG - Intergenic
1198105296 X:133455872-133455894 AGAAGAAGGGGAGGAGGAAGAGG + Intergenic
1198233350 X:134714284-134714306 AGAAGCAGGAGAGGAGGGAAAGG - Intronic
1198682986 X:139202733-139202755 AGAAGGAGGAGAGGAGAACAAGG + Intronic
1199429272 X:147740650-147740672 AGGAGAAAGGGAGGAGACCAAGG - Intergenic
1199728001 X:150603989-150604011 AGAAGGAAGGGAGCAGACCATGG + Intronic
1199881568 X:151977484-151977506 TGGAGTTGGGGAGGAGGCAAAGG + Intergenic
1199980125 X:152916305-152916327 AGAGTTAGGGGAGGAGTCAAGGG - Intronic
1199991593 X:152990379-152990401 AGCACTAGGGGAGAAGACCATGG - Exonic
1200374713 X:155767578-155767600 GGAAGAAGGGGAGGAGGGAAAGG + Intergenic
1200406604 Y:2818307-2818329 AGCACTTTGGGAGGAGGCCAAGG + Intergenic
1200730196 Y:6727355-6727377 AGATGTAGGGGAGGAGGAGGAGG + Intergenic
1201154308 Y:11115777-11115799 AGAAGTAGGGAAGGAGGCCAGGG + Intergenic
1201550002 Y:15209443-15209465 GGAAGGAGGGGAGGAGGGGACGG + Intergenic
1202585694 Y:26424260-26424282 AAAAGTAGGAGAGGAGTCAAAGG + Intergenic