ID: 1025132409

View in Genome Browser
Species Human (GRCh38)
Location 7:56383194-56383216
Sequence GAGAAGTAGGGGAGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1098
Summary {0: 13, 1: 15, 2: 16, 3: 96, 4: 958}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132409_1025132419 13 Left 1025132409 7:56383194-56383216 CCTGGCCTCCTCCCCTACTTCTC 0: 13
1: 15
2: 16
3: 96
4: 958
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132409_1025132420 18 Left 1025132409 7:56383194-56383216 CCTGGCCTCCTCCCCTACTTCTC 0: 13
1: 15
2: 16
3: 96
4: 958
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132409 Original CRISPR GAGAAGTAGGGGAGGAGGCC AGG (reversed) Intergenic
900016083 1:151074-151096 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
900046347 1:509668-509690 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
900281488 1:1872486-1872508 CAGAGGTAGGGGTGGAAGCCAGG - Intronic
900375888 1:2354589-2354611 GAGAAGAGGAGGGGGAGGCCAGG - Intronic
900471500 1:2857206-2857228 GGGAAGCAGCGGAGGAGGCCGGG - Intergenic
900636912 1:3670367-3670389 TAGAAGTGGGGAAGAAGGCCAGG + Intronic
900710026 1:4107823-4107845 CAGGAGGAGGGGAAGAGGCCGGG - Intergenic
901010928 1:6201723-6201745 GATAAGGACGGGAGGAGGCTGGG - Intronic
901128047 1:6943162-6943184 GGGGAGGAGGGGAGGAGGGCCGG - Intronic
901138444 1:7012524-7012546 GAGAAAGAGAGGAGGGGGCCTGG - Intronic
901234684 1:7661568-7661590 GATGAGTAGGGGAGGAGGAGGGG - Intronic
901495350 1:9618022-9618044 GTGAAGGAGGGGAGGACTCCGGG + Intergenic
901870976 1:12139089-12139111 GAGAAGCAAGAGAGGAGGCAGGG - Intronic
902005764 1:13230753-13230775 GAGAAGTAAGGGTGGTGGCTGGG + Intergenic
902025079 1:13377040-13377062 GAGAAGTAAGGGTGGTGGCTGGG + Intergenic
902060848 1:13641198-13641220 GAGCAGCAGGAGAGGAGGCTGGG + Intergenic
902183259 1:14705771-14705793 GGGGAGTAGGGAAGGAGGCATGG + Intronic
902397615 1:16141026-16141048 CAGAAGTGGGAAAGGAGGCCCGG - Intronic
902550985 1:17219493-17219515 GTGAAGGAGGGGATGAGGCCAGG + Intronic
902559311 1:17267134-17267156 GAGAATTTGGGGAAAAGGCCTGG - Intronic
902577494 1:17387451-17387473 GAAAAGGAGGGGGGGGGGCCAGG + Intronic
903800545 1:25964008-25964030 GAACAGCAGGGGAGGAGGCCAGG + Intronic
904166762 1:28561592-28561614 GAGTAGCAGGGTAGGAAGCCAGG - Intronic
904277491 1:29393930-29393952 GAGAAGGAGGGGAGGAGGGGAGG - Intergenic
905197085 1:36288297-36288319 GAGAAGGATGGGAGGGGGCAAGG - Intronic
905209959 1:36367231-36367253 GAGGGTGAGGGGAGGAGGCCAGG + Intronic
905557368 1:38897833-38897855 GAGAAGTAGTCCAGTAGGCCGGG + Intronic
905803324 1:40859688-40859710 TTGAAGTCAGGGAGGAGGCCGGG - Intergenic
905902274 1:41589450-41589472 GGGAAGTAATGGAGGAGCCCGGG + Intronic
906033449 1:42737113-42737135 GAGAAGTGAGGGAGGAGCCAAGG + Intronic
906036712 1:42755033-42755055 GGGAAGTCGGGGTGGAGCCCAGG - Intronic
906109183 1:43312075-43312097 GGGAAGGAGGAGAGGGGGCCTGG + Exonic
906116798 1:43362567-43362589 GAAAAAAAAGGGAGGAGGCCAGG + Intronic
906479095 1:46188746-46188768 GAGAAGGCTGAGAGGAGGCCTGG + Exonic
906662762 1:47594103-47594125 GAGCAGTAGTGGAGGAGCCAGGG + Intergenic
907289945 1:53407266-53407288 GAGGACTGGGGGAGGAGGCCAGG + Intergenic
907497091 1:54852398-54852420 GAGAAGTGGGTGAGGACGCCAGG + Intronic
907528551 1:55070015-55070037 GAGAAGCAGGGGTGGAGGTGAGG + Intronic
907560801 1:55385708-55385730 GAGAGGTAGGGGAGGAAGGGAGG - Intergenic
907756400 1:57314839-57314861 GGGAAGAAGGGAAGGAGGCAAGG + Intronic
911039962 1:93583581-93583603 GAGAGGAAGGGGAGTTGGCCTGG + Intronic
911096569 1:94060083-94060105 TAGCAGTAGGGGAGGAGATCTGG - Intronic
912626029 1:111204814-111204836 GACAAGTAGGGCAAGAGACCTGG - Intronic
912775518 1:112504276-112504298 GGGAAGGAGGAGAGGAGGCGTGG - Intronic
912947336 1:114096086-114096108 GATAAGTGGGGGAGGAGGGGTGG + Intronic
913192613 1:116426299-116426321 GGGAGGTAGGGGTGGTGGCCTGG + Intergenic
913601032 1:120421354-120421376 GAGAAGTAGGGAAGGAAGGAAGG - Intergenic
914086020 1:144455275-144455297 GAGAAGTAGGGAAGGAAGGAAGG + Intronic
914191916 1:145419234-145419256 GAGAAGTAGGGAAGGAAGGAAGG + Intergenic
914254234 1:145947980-145948002 GAAAAGTGGTGGAGGAGGGCAGG - Intronic
914348703 1:146821461-146821483 GAGACTTAGGGGAAGAGGCCGGG + Intergenic
914589820 1:149097180-149097202 GAGAAGTAGGGAAGGAAGGAAGG + Intronic
915774007 1:158462421-158462443 GAGAAGTAGAGGAGGAAGGAAGG - Intergenic
916079395 1:161223124-161223146 CAGAGGTATGGCAGGAGGCCAGG - Intronic
916486933 1:165268048-165268070 GGGAAGTTGGGGAGGAGTACTGG + Intronic
916500039 1:165378731-165378753 TAGAAGTAAGGAAGCAGGCCGGG - Intergenic
917035089 1:170740106-170740128 GAGAAGAAGGGGTGAAGGCAGGG + Intergenic
917067439 1:171112153-171112175 GAGAATGAGGGGAGAATGCCAGG + Intronic
917147536 1:171908900-171908922 GGGAAGTAGGGAAGGAGGGAGGG - Intronic
917302266 1:173588776-173588798 AATAAGTAAGGGAGGAGGCCAGG + Intronic
917388163 1:174500775-174500797 GAGAAGGAAGGAAGGAGGCATGG + Intronic
917536758 1:175879769-175879791 GAGAAAAAGGGAAGGAGGACAGG - Intergenic
917598393 1:176552414-176552436 GAAAAGAAGGGGAGAAGGACAGG - Intronic
918002949 1:180514621-180514643 GAGGAGGAGGGGAGGAGGAGGGG + Intergenic
918206019 1:182310090-182310112 AAGAAGCAGGGTAGGAAGCCTGG + Intergenic
918472066 1:184885001-184885023 GTGATGTTGGGTAGGAGGCCAGG - Intronic
919133163 1:193476119-193476141 GAAAAGATGGGGAGGAGGACAGG - Intergenic
919819429 1:201463724-201463746 CAGAAATAGGGGAGTGGGCCGGG - Intergenic
919916690 1:202143855-202143877 GAGAAGTTGGGGAGGAGTCTGGG + Intronic
920055057 1:203185392-203185414 GAGAAGTCTGGGATGGGGCCCGG + Intronic
920379999 1:205529628-205529650 CAGAAGTTGGGGCGTAGGCCCGG - Intronic
920912549 1:210232556-210232578 GGGAAGCAGGGAAGGAGGCAGGG + Intergenic
920957153 1:210630134-210630156 GAGAGACAGAGGAGGAGGCCAGG - Intronic
921434776 1:215105728-215105750 AAGAAGGAAGGGAGGAGGGCAGG - Intronic
922026463 1:221754481-221754503 AAGAAGTGAGGGAAGAGGCCGGG + Intergenic
922101593 1:222481831-222481853 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922103904 1:222496752-222496774 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
922262674 1:223956947-223956969 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922264225 1:223969283-223969305 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
922476282 1:225908902-225908924 GAGAAGCAGGTGTGGAAGCCAGG - Intronic
922570778 1:226633702-226633724 TAGAAATAGGGGAGGAGCTCAGG - Exonic
923051911 1:230395528-230395550 GAGGAGGAGGGGAGGAGGGTGGG - Intronic
923136068 1:231120435-231120457 CAGGAGTAGAAGAGGAGGCCAGG + Intergenic
923478519 1:234360069-234360091 GAAAAGTAAGGAAAGAGGCCGGG + Intergenic
923642129 1:235774341-235774363 AAGAAGTAGGGGTGGAGGCAAGG + Intronic
923762280 1:236857865-236857887 GAGAAATAAAGGAGGTGGCCAGG + Intronic
923867951 1:237960740-237960762 GATAAGGAGAAGAGGAGGCCTGG - Intergenic
924327304 1:242908914-242908936 GAGAAGGAGGGGAGGAGGAAGGG - Intergenic
924344513 1:243061948-243061970 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924346074 1:243074276-243074298 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
924932567 1:248743774-248743796 GAGAGGTAGTGGAGGAAGGCAGG - Intronic
1062907265 10:1187362-1187384 GAGGAGGAGGGGAGGCCGCCTGG - Intronic
1062907278 10:1187397-1187419 GAGGAGGAGGGGAGGCCGCCTGG - Intronic
1063222043 10:3978049-3978071 GAGAGGAAGGAGAGGAGGTCTGG - Intergenic
1063252876 10:4293436-4293458 AAGAAGCAGGGTAGGAGTCCTGG - Intergenic
1063582786 10:7324424-7324446 GAGAAGACGCGGAGGAGACCAGG + Intronic
1064555071 10:16539779-16539801 GAGAGGTAGAGGAGGAGGGCAGG - Intergenic
1064590524 10:16885621-16885643 GAGAAAAAGGGGAGCAGCCCTGG - Intronic
1064996142 10:21298111-21298133 GAGAAGGAGGGGAGGAAGGAAGG + Intergenic
1065428905 10:25633571-25633593 AAGAAGGTGGGGAGGAGGTCAGG - Intergenic
1065874327 10:29983841-29983863 GAGAAGGAGGGAAGGAGGGAAGG + Intergenic
1065886962 10:30087145-30087167 GTCAAGTCTGGGAGGAGGCCAGG + Intronic
1065967053 10:30779082-30779104 GAGCAGGAGGGGAGGAGGAAGGG + Intergenic
1066131720 10:32401027-32401049 GAGAGGGAGGGGAGGAGGAAAGG - Intergenic
1066178216 10:32933039-32933061 GAGAAGGTGGGGAGGAAGTCGGG - Intronic
1066335201 10:34469739-34469761 GAGAAATGGGAGAGGAGACCAGG + Intronic
1066653208 10:37678981-37679003 GAGAAGTACCCCAGGAGGCCAGG - Intergenic
1066730272 10:38430544-38430566 GTGAAGTCAGCGAGGAGGCCAGG + Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1066731820 10:38443124-38443146 GAGAAGTAGGGGAGGAGGCCAGG + Intergenic
1067171502 10:43910591-43910613 AAGAAGGATGGGAGGAGCCCTGG + Intergenic
1067415226 10:46097463-46097485 GCTCAGGAGGGGAGGAGGCCAGG + Intergenic
1067541936 10:47161122-47161144 AAGAAGAAGAGGAGGGGGCCGGG - Intergenic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068226617 10:54114868-54114890 GAGAAGTAGGAGATGAGGTCAGG + Intronic
1068620516 10:59176738-59176760 CAGAGGGAGGGAAGGAGGCCTGG - Exonic
1068815449 10:61305418-61305440 AAGAAGTAAGAGAGGAGGCCGGG + Intergenic
1069424702 10:68279088-68279110 GCGGAAGAGGGGAGGAGGCCTGG + Intergenic
1069551601 10:69368162-69368184 GGGAAGTGGGGAAGGGGGCCAGG + Intronic
1069790094 10:71013967-71013989 GAGGAGCAGAGGAGGAGCCCTGG + Intergenic
1069791314 10:71023854-71023876 AAGAAGTAGGCTAGGAGGCTAGG + Intergenic
1069793290 10:71036939-71036961 GGTAAGTTGGGCAGGAGGCCTGG + Intergenic
1069799466 10:71073102-71073124 GAGAGGGAGGGGAGAAGCCCTGG - Intergenic
1070314130 10:75294778-75294800 GAGAGGAAGAGGGGGAGGCCCGG + Intergenic
1070327552 10:75398691-75398713 GAGGGGGAGGGGAGGAGTCCAGG - Exonic
1070406936 10:76105548-76105570 GAGACACAGGGGAGAAGGCCAGG + Intronic
1070617707 10:77981727-77981749 GAGAAGTATGCTGGGAGGCCGGG + Intronic
1070642415 10:78179323-78179345 GAGAAGGAGGGGAGAAGGATGGG + Intergenic
1070913726 10:80139381-80139403 GAGGTTTAGGAGAGGAGGCCTGG - Intronic
1071260248 10:83912929-83912951 GAGAAGTGGGCGATGAGGGCAGG + Intergenic
1071337204 10:84610500-84610522 GGGAAGTAGGGAAAGAGGACAGG + Intergenic
1071378743 10:85036322-85036344 GGGAAAGAGGGGAGGAGGCAAGG + Intergenic
1071475753 10:86023745-86023767 GCGGAGTCTGGGAGGAGGCCTGG - Intronic
1071610352 10:87026187-87026209 GAGAAGAAAGAGAGAAGGCCAGG - Intergenic
1071732903 10:88266997-88267019 AAGAAGGAGGGAAGGAGGACTGG - Intergenic
1072537972 10:96377686-96377708 GAGAGGCAGGTGAGGAGGGCCGG + Intronic
1072586773 10:96789895-96789917 GAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1072636546 10:97182044-97182066 GAGAGGTGGCGGAGGCGGCCCGG - Intronic
1073455440 10:103634068-103634090 CAGAGGTAGGAGCGGAGGCCAGG + Intronic
1073463239 10:103678510-103678532 GAGAAGCCAGGAAGGAGGCCTGG + Intronic
1073871563 10:107870925-107870947 CAGAAGTAAGGAAGGGGGCCGGG + Intergenic
1074377527 10:112951710-112951732 GGGAGGGAGGGGAGGAGGCGGGG - Intronic
1075106349 10:119542515-119542537 AAGAGGGAGGGCAGGAGGCCGGG + Intronic
1075456250 10:122586878-122586900 AAGAAGATGGGGAGGTGGCCTGG + Intronic
1075670490 10:124260991-124261013 GTGAAGGAGGGGAGGAGGCAGGG - Intergenic
1076048338 10:127312809-127312831 GAGAAGGAGGGAAGGAGGGAGGG - Intronic
1076257899 10:129042872-129042894 GAGAAGGAGGGGAGGAGGGAAGG - Intergenic
1076294879 10:129376485-129376507 GACAAGTAAGGGAGGGGCCCAGG + Intergenic
1076314413 10:129530790-129530812 GAGAGCTGGGGGATGAGGCCTGG - Intronic
1076318971 10:129564483-129564505 GAGGAGGAGGGGAGGAGGAAGGG - Intronic
1076542644 10:131223928-131223950 GAGAAGGTGGGGATGTGGCCTGG - Intronic
1076588998 10:131570412-131570434 GAGAAGGAGGGGAGCAGGGGAGG + Intergenic
1076718770 10:132383343-132383365 CAGAAGTGGGGGAGGAGGCAGGG - Intergenic
1076882775 10:133247683-133247705 GAGAAGTCGGGACTGAGGCCTGG + Intergenic
1076972673 11:146141-146163 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
1077017466 11:403332-403354 GAGAGGGAGGGGAGGAGGAAGGG + Intronic
1077025442 11:437948-437970 GAGAAGGAAGGGACGAGGCAGGG + Intronic
1077557234 11:3231558-3231580 GAGAAGGAGGGGAGGAGGCGGGG + Intronic
1077557257 11:3231624-3231646 GAGAAGGAGGGGAGGAGGCGGGG + Intronic
1077875455 11:6301277-6301299 GAGAAAGAGGGCAGGAGGACAGG - Intergenic
1078024136 11:7678790-7678812 GAGAGGAAGGGAAGGAGGCATGG + Intergenic
1078168501 11:8911077-8911099 GAGAAGTGGGGGAGGCGGGGCGG - Intergenic
1078526758 11:12107399-12107421 GAGAAGGAGGGAAGGAGGGAGGG - Intronic
1079137559 11:17784562-17784584 ATGAAGTAGGGCAGGAGGCCAGG - Intergenic
1079317231 11:19418970-19418992 GGGAGGTAAGGGAGGAGGCAAGG + Intronic
1079689086 11:23400196-23400218 GAGAAGTACGGGAGGGAACCCGG + Intergenic
1079984969 11:27190587-27190609 GAAAAGGAGGGAATGAGGCCGGG - Intergenic
1080055563 11:27902904-27902926 TAGAAGAAGGGGAGGTGGCAAGG + Intergenic
1080617324 11:33955870-33955892 GAGAAGAGGGAGGGGAGGCCGGG + Intergenic
1080675844 11:34426191-34426213 GAGGTGGAGGGAAGGAGGCCTGG - Intergenic
1080801572 11:35615168-35615190 TGGAAGCAGGGGAGGAGGCTTGG - Intergenic
1081310683 11:41567924-41567946 GAGAAATAGTGGTTGAGGCCGGG - Intergenic
1082261956 11:50083286-50083308 GAGAAGTAGGGGAGAAGGCCAGG - Intergenic
1083276887 11:61601940-61601962 GAGAGACAGGGGAAGAGGCCTGG - Intergenic
1083307619 11:61769387-61769409 GGGAGGTAGGGGAGGAGGGAGGG + Intronic
1083334219 11:61913420-61913442 GAGGAGTGGGGGAGAAGGTCAGG + Intronic
1083472725 11:62894983-62895005 GAAAAGTAGCTGAGGAGGCTAGG + Intergenic
1083718845 11:64594000-64594022 GAGGAGCAGGGGAGGCGCCCTGG - Intronic
1083721695 11:64606709-64606731 AAGAAGTAGGGAAGGAGGGTGGG + Exonic
1084003858 11:66313253-66313275 GGGAAGGAGGTGAGGAAGCCTGG - Intergenic
1084163977 11:67366630-67366652 GAGAAGCAAGGGGAGAGGCCTGG + Intronic
1084525533 11:69695531-69695553 GAGGAGTAGGGGAAGAGTCGGGG + Intergenic
1084584345 11:70048657-70048679 GGGGAGAAGGGGAGGAGGGCGGG - Intergenic
1084596773 11:70121187-70121209 GAGAAGTGGGGGAGGGAGACGGG - Intronic
1084596794 11:70121331-70121353 GAGAGGTGGGGGAGGAAGACAGG - Intronic
1084944438 11:72631174-72631196 GGGGAGAAGGGGAGAAGGCCTGG - Intronic
1085037129 11:73307560-73307582 GAAAAGTAGGGGTGGGGGCGCGG + Intergenic
1085345352 11:75765039-75765061 AAGAAGCATGGGAGGGGGCCAGG + Intronic
1085508911 11:77075423-77075445 GAGAGCTAGAGGAGGAGGCTGGG + Intronic
1085801508 11:79594126-79594148 AAGAAGGAGGGGAGCCGGCCGGG + Intergenic
1086041370 11:82483235-82483257 AAGAAATAGGGGAGCAGGGCAGG - Intergenic
1086284274 11:85227786-85227808 GAGTAGTAGCAGATGAGGCCAGG - Intronic
1086450526 11:86911461-86911483 GAGGAGGATGGAAGGAGGCCAGG - Intronic
1087375132 11:97330142-97330164 AAGAAGAAGGGGAGCAGGCTGGG - Intergenic
1088365602 11:109036958-109036980 GAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1088731819 11:112690188-112690210 TGAAAGTAGGGGAGAAGGCCGGG + Intergenic
1088844273 11:113651767-113651789 GAGAATCAGCAGAGGAGGCCAGG - Intergenic
1089306935 11:117532358-117532380 GACAGGTAGGGGAGAGGGCCTGG - Exonic
1089586979 11:119516039-119516061 GAGAAGTTGGGTAGGAGGGGCGG - Intergenic
1089685198 11:120142179-120142201 GAGAAGCCTGGGAGGAGGCTTGG - Intronic
1089692290 11:120194347-120194369 GTGGAGGAGGGGAGCAGGCCAGG - Intergenic
1090039168 11:123275247-123275269 GAGAAGGAGGGCAGGAAGTCAGG - Intergenic
1090134520 11:124183534-124183556 GGGAAGGAGGGAAGGAGGCAGGG - Intergenic
1090264738 11:125346832-125346854 AGGAAGGAGGGGAGGAGGTCAGG + Intronic
1090414373 11:126530570-126530592 GAGGAGCAGGGGAACAGGCCTGG + Intronic
1090493128 11:127183456-127183478 GAGAAGGAGGAGAGGAGGTGAGG + Intergenic
1090548461 11:127792150-127792172 GAGAAGTAAGGGAAGAGGCAGGG - Intergenic
1090605789 11:128421928-128421950 GTGAAGCAGGGCAGGAGGCTGGG - Intergenic
1091070536 11:132558468-132558490 GAGGAGGAGTGGAGGAGGACAGG - Intronic
1091543909 12:1487739-1487761 GAGGAGAAGGGTAGGAGGCAAGG + Intronic
1091858870 12:3760860-3760882 GTGCAGGAGGGGAGGAGGTCTGG - Intronic
1092166917 12:6348037-6348059 GGGAAGGAGGGGAGGATGCCAGG + Exonic
1092456156 12:8644767-8644789 GAGAAGTGGGGAAGGGGTCCTGG - Intronic
1092650786 12:10632471-10632493 GAGTAGTAGGAGACAAGGCCAGG + Intronic
1092682552 12:11001530-11001552 GAGGAGGATGGGAGGAGGCAAGG - Intronic
1092776749 12:11950222-11950244 GACAGGTGAGGGAGGAGGCCGGG + Intergenic
1092782062 12:11996466-11996488 GAGAAGTATGGGAAGAGGCACGG + Intergenic
1092981557 12:13799712-13799734 GAGGAGCAGGGAAGGAGGACTGG + Intronic
1093192930 12:16095661-16095683 GAGAAGGAAGGGAGGAAGGCAGG + Intergenic
1093208106 12:16275288-16275310 GAAAACTAGGGAAGGAGGCCAGG + Intronic
1093675950 12:21941025-21941047 TAGAATTAAGGGACGAGGCCCGG - Intronic
1093685100 12:22046274-22046296 GAGAAGCTGGGGAGAAGGCGTGG + Exonic
1094053261 12:26243386-26243408 GAGTAGGAGGGGAGGTGGCTTGG - Intronic
1094107952 12:26833261-26833283 GAGGAGGAGGAGAGGAGCCCTGG + Intergenic
1095812285 12:46383618-46383640 GAGGAGGCGGGGAGGAGGCGGGG + Intergenic
1096105505 12:48995071-48995093 GGGAAGTAGCAGAGGAGTCCCGG + Intergenic
1096886158 12:54721345-54721367 GAGGAGGAGGGGAGGAGGAGTGG - Intergenic
1097011165 12:55954457-55954479 GAGGAGAAGGGGAGGAAGCTAGG - Intronic
1097050684 12:56221507-56221529 GAGAAGTGCGGGAGGGGGCCGGG - Intronic
1097168189 12:57096776-57096798 GAGAAGCAGTGGAGTAGGCATGG + Intronic
1097237824 12:57551715-57551737 GGAAAGAAGGGGAGGAAGCCTGG + Intronic
1098137330 12:67416502-67416524 GAGAAGCAGGGAAGGAGGAAGGG - Intergenic
1098560854 12:71870234-71870256 GAGGAGAAGGGGAGGAGGAAAGG - Intronic
1099385295 12:82006222-82006244 GAGAAGAAGGGAAGGAGGGAGGG + Intergenic
1099438158 12:82668312-82668334 GGGAAGGAGGGGAGGAGGGAGGG - Intergenic
1100295604 12:93258017-93258039 GAGAAATAAAGGAGAAGGCCAGG - Intergenic
1100519226 12:95357404-95357426 GAAAAATAAGGAAGGAGGCCGGG - Intergenic
1100916567 12:99430352-99430374 GAGAAGTAGAGGAGGAGTCTAGG + Intronic
1101007046 12:100411164-100411186 AAAAAATAGGGGAAGAGGCCAGG + Intronic
1101653112 12:106695450-106695472 GAGGTGTAGGGGAGGCGGCAAGG + Intronic
1102126771 12:110489207-110489229 AAGAAGTAGGGAAGTTGGCCAGG + Intronic
1102152286 12:110697097-110697119 GAGAAGCCTGGGAGGGGGCCAGG + Intronic
1102425075 12:112837846-112837868 GGGAAGGAGGGGAGGAGCCTGGG - Intronic
1102494625 12:113311017-113311039 AAGAATTATGTGAGGAGGCCGGG + Intronic
1102871831 12:116419813-116419835 GAGAAGTGGGGGAATAGGTCAGG + Intergenic
1102955897 12:117058894-117058916 GAAAGGCAGGGGAGGAGGGCAGG - Intronic
1103763938 12:123269065-123269087 GAGCAGTTGGGGAAGAGGACGGG - Intronic
1104051320 12:125195754-125195776 AAGGGGTAAGGGAGGAGGCCAGG + Intronic
1105603722 13:21909868-21909890 GCGAAGAAGGGCAGGAGCCCAGG + Intergenic
1105938757 13:25128288-25128310 CAGAAGGTGGGGAGGCGGCCAGG + Intergenic
1106407530 13:29486993-29487015 GAGGGGTAGGGGAGGGGGTCAGG + Intronic
1107379941 13:39845813-39845835 AAGAAGAAGGGGAGAGGGCCAGG - Intergenic
1107387799 13:39931405-39931427 GAGAAGAAGGAAGGGAGGCCTGG + Intergenic
1107403033 13:40087499-40087521 GAAAGGGAGGGGAAGAGGCCGGG + Intergenic
1107513442 13:41107336-41107358 GTGGAGTAGAGCAGGAGGCCTGG - Intergenic
1107650510 13:42540387-42540409 GTGAGGTAGGGGAGGAGACGAGG + Intergenic
1107846677 13:44521443-44521465 GAGATGAAGGGGAGGAGTCCAGG - Intronic
1107880350 13:44827061-44827083 GAGGGGTAGGGCAGGTGGCCTGG - Intergenic
1108046421 13:46388228-46388250 GAGAAGAAGGGAAGGAGGGAGGG + Intronic
1109734591 13:66466189-66466211 GAGAAGGAGGGGAGGAGAGGAGG - Intronic
1110542739 13:76724005-76724027 GAGAAGGAGGGAAGGAGCCAGGG - Intergenic
1110816481 13:79865941-79865963 GAGAGGAAGGGGAGGAGGAGAGG + Intergenic
1110845616 13:80187753-80187775 GAGAGGTAGTGGAGGGGGGCAGG - Intergenic
1111897168 13:94156001-94156023 AAGAAGTAGGGTAGCATGCCTGG + Intronic
1113040520 13:106099962-106099984 GAGAGTTCAGGGAGGAGGCCGGG + Intergenic
1113236274 13:108278630-108278652 GAGAAGTGGAGGAGGAGGAAAGG - Intronic
1113598884 13:111554451-111554473 GGGAGGGAGGAGAGGAGGCCTGG - Intergenic
1113654321 13:112058435-112058457 TAGGTGCAGGGGAGGAGGCCGGG - Intergenic
1114252243 14:20971447-20971469 GTGAGGGAGGGGAGGAGGGCTGG - Intergenic
1114264905 14:21068292-21068314 GAGAAAAAGGGGAGCCGGCCGGG - Intronic
1115356580 14:32454699-32454721 GAGAAGGAGGGAAGGAGGGAGGG - Intronic
1115356626 14:32454811-32454833 GAGAAGGAGGGAAGGAGGGAGGG - Intronic
1115356655 14:32454883-32454905 GAGAAGGAGGGAAGGAGGGAGGG - Intronic
1117579857 14:57141734-57141756 GAGAAGTAAGGGTGGAGGTTAGG - Intergenic
1117665244 14:58049865-58049887 GAGCAGTAGTGGAGGTGCCCGGG - Intronic
1117690331 14:58299167-58299189 GAGGAGGAGGGGAGGTGGCCCGG - Intronic
1117865869 14:60148680-60148702 GAGAAGTGGGAGGGAAGGCCAGG + Intronic
1117980481 14:61337993-61338015 GACAAGAAGGCGAGGAGGCCCGG - Intronic
1118582377 14:67315367-67315389 GAGAAGAAGGGCATGAGCCCGGG - Intronic
1118892946 14:69924714-69924736 GAGAGGTAGGGGAGGAGGAGAGG + Intronic
1118893011 14:69924892-69924914 GAGAGGTAGGGGAGGAGGAGAGG + Intronic
1118893130 14:69925236-69925258 GGGAAGCAGGGGAGGAGGGGAGG + Intronic
1119067395 14:71542615-71542637 AAGAAGAAGGGGAGGAGGAGGGG - Intronic
1119406881 14:74404600-74404622 GGGGAGTAGGGAAGGAGGCAGGG + Intergenic
1119638398 14:76294899-76294921 TAGAAGAAAGGAAGGAGGCCAGG - Intergenic
1119668122 14:76499128-76499150 GAGGAGAAGAGGAGGAGGACAGG - Intronic
1120722943 14:87907191-87907213 AAGAATTGGGGGAGGGGGCCAGG - Intronic
1120882734 14:89426933-89426955 GAGAAATAGAAGAGGAGGGCCGG + Intronic
1121511541 14:94516442-94516464 GAGAACTGAAGGAGGAGGCCTGG + Intronic
1121550488 14:94795982-94796004 GAGAAGGAGGGTTGGAGGCAGGG + Intergenic
1121618899 14:95332525-95332547 GAAAAGGAGGGAAGGAGTCCTGG - Intergenic
1121657683 14:95609757-95609779 GAGAAGTAGGCAGGGAGGACTGG - Intergenic
1121792962 14:96712597-96712619 TTAAACTAGGGGAGGAGGCCGGG + Intergenic
1121957085 14:98223950-98223972 GAGAAGGAAGGGAGGAGCCCAGG + Intergenic
1122069497 14:99196425-99196447 GAGGGGAAGGGGAGGATGCCAGG - Intronic
1122126048 14:99579352-99579374 GAGAAGTGGGGGAGGGGGGCAGG + Intronic
1122323453 14:100868869-100868891 GAGAGGGAGAGGAGGAAGCCAGG - Intergenic
1122329899 14:100904924-100904946 GAAGAGTGGGGGAGGAGGCCGGG + Intergenic
1122686802 14:103512445-103512467 AAGAATTTAGGGAGGAGGCCGGG - Intergenic
1122904692 14:104796206-104796228 GGGAAGTGCGGGAGGATGCCAGG + Intergenic
1122917823 14:104866867-104866889 GAGGAGAAGGGGAGGCTGCCGGG - Intronic
1123062161 14:105599297-105599319 GGGCAGTAGGAGAGGGGGCCTGG + Intergenic
1123086906 14:105721025-105721047 GGGCAGTAGGAGAGGGGGCCTGG + Intergenic
1123474770 15:20581977-20581999 GAGGAGGAGGGCAGGAGGCACGG - Intergenic
1123643241 15:22418380-22418402 GAGGAGGAGGGCAGGAGGCACGG + Intergenic
1124139361 15:27063870-27063892 GGGAAGTGGGTGAGCAGGCCGGG - Intronic
1124802081 15:32842828-32842850 GAAAGGTAGGGGAGAGGGCCAGG + Intronic
1124896968 15:33786177-33786199 GATGAGTAGGGGAGTGGGCCGGG - Intronic
1124899101 15:33805985-33806007 GAGAAGGAGGGCAGGAGGGAAGG - Intronic
1124957826 15:34371111-34371133 GAGGAGGAGGGGAGGAGGGGAGG - Intergenic
1125066129 15:35487585-35487607 GAGCAGTGGGGCAGTAGGCCTGG + Intronic
1125349039 15:38748403-38748425 GAAAATTAGGGGAGAAAGCCAGG - Intergenic
1125610476 15:40966094-40966116 GGGAAGTGTGGGAGGAGGCAGGG + Intergenic
1126377473 15:48010768-48010790 ATGAAGTTGGGGAGGGGGCCTGG - Intergenic
1126736089 15:51733482-51733504 GGGAAGTTGGGGAGGAGCGCTGG + Intronic
1127160928 15:56184694-56184716 GAAAAGTAAGGGAGCAAGCCAGG - Intronic
1128248986 15:66151836-66151858 GATAAGAAGGGGAGCAGGGCTGG + Intronic
1128320521 15:66690574-66690596 GAGAATCAGGGGAGGCTGCCTGG - Intergenic
1128746071 15:70115063-70115085 GATTAGAAGGGGAGAAGGCCAGG - Intergenic
1128767615 15:70260779-70260801 GAGCAGTGGGGCAGGAGGCTGGG + Intergenic
1129166497 15:73781210-73781232 GAGGAGTAGGGGATGAGCCTGGG - Intergenic
1129239800 15:74244573-74244595 GAGAAGGAGGGGAGGAGGGGAGG - Intronic
1129301286 15:74627058-74627080 GAGAGACAGGTGAGGAGGCCTGG + Intronic
1129891782 15:79076417-79076439 GAGGAGCAGGGGAGAAGTCCTGG - Intronic
1130013774 15:80172275-80172297 GAGATGACGGGGAGGAGGCTGGG + Intronic
1130078462 15:80710278-80710300 GAGTAGTAGGAGATGAGGACTGG + Intronic
1130155833 15:81349273-81349295 GAGGGATAGGGGAGGAGGCAGGG - Intronic
1130204431 15:81863050-81863072 GAGAGGTGGGGGAGAAGGGCGGG + Intergenic
1130225976 15:82058756-82058778 GAGGAGTTGGGGAGGAGGAAGGG - Intergenic
1130539495 15:84811946-84811968 GGGAAGGAGGGAAGGAGGCCAGG + Intergenic
1130561749 15:84964314-84964336 GAGAAACAGGGAAGGAGGCAAGG + Intergenic
1131139868 15:89968245-89968267 GAGAAGGAGGGGAGGAGGAGGGG + Intergenic
1131251002 15:90829976-90829998 GAGGAGTAGGGCAGAAGGCTGGG + Intergenic
1131290511 15:91102818-91102840 GGGAAGTGAGGGAGGAAGCCAGG + Intronic
1131312756 15:91305851-91305873 ACGCAGAAGGGGAGGAGGCCGGG + Intergenic
1131540338 15:93270158-93270180 GAGGAGGAGGGTAGGAGGCACGG + Intergenic
1131997098 15:98143554-98143576 GAGCAGAAGGTGAGGAGGTCTGG - Intergenic
1132584992 16:702226-702248 GAGGAGCAGGGGAGGAGGAATGG - Intronic
1132692868 16:1189339-1189361 GTGAGGAAGGGGAGGTGGCCAGG + Intronic
1132721153 16:1316278-1316300 GAGAAGAAAGGGCTGAGGCCAGG + Intronic
1132724245 16:1332077-1332099 GGGAAGCAGGGGAGGGGGCCTGG - Intergenic
1132897222 16:2234802-2234824 GAGGGGGAGGGGAGGGGGCCGGG + Intronic
1133520213 16:6549341-6549363 GAGGAGGAGGGGAGGAGGGAAGG + Intronic
1133930003 16:10224339-10224361 GATAAGAAGTGGTGGAGGCCTGG - Intergenic
1133976069 16:10600668-10600690 GAGAGGGAGGGGAGGGGCCCGGG + Intergenic
1135619966 16:23947376-23947398 GAGAATGAGGAGAGGAGCCCAGG - Intronic
1136055431 16:27685089-27685111 GAAAAGTATTTGAGGAGGCCAGG + Intronic
1137495451 16:48965782-48965804 GAGAAGCAGGGGTGGCGTCCTGG - Intergenic
1137613504 16:49834496-49834518 GGGAAGAATGGGTGGAGGCCAGG + Intronic
1137774012 16:51040878-51040900 GAGAAGGAGGGGAGGAAGGAGGG + Intergenic
1137774043 16:51040976-51040998 GAGAAGAAGGGAAGGAGGGAGGG + Intergenic
1137801028 16:51262166-51262188 GAGAAGGAGGGAAGGAGGGAAGG - Intergenic
1138166497 16:54806580-54806602 GAGCAGTAGGTGAGAAGGACGGG - Intergenic
1138436262 16:57001891-57001913 GGGAAGTATAGTAGGAGGCCAGG - Intronic
1139007743 16:62594033-62594055 AAGAAGAAAGGGAAGAGGCCGGG + Intergenic
1139600006 16:67980639-67980661 CACGAGTGGGGGAGGAGGCCAGG + Exonic
1139775967 16:69317153-69317175 GCGAGGCAGGGGTGGAGGCCAGG + Intronic
1139948423 16:70657256-70657278 GAGAAGTGGGGGAGGGGTGCAGG + Intronic
1139985333 16:70894087-70894109 GAGACTTAGGGGAAGAGGCCGGG - Intronic
1140663977 16:77212384-77212406 GAGGAGTGGGCGAGGAGGGCAGG + Intronic
1140997065 16:80271466-80271488 CAGAAGTTGGGAAAGAGGCCTGG + Intergenic
1141113135 16:81286779-81286801 TAAAACTGGGGGAGGAGGCCGGG + Intronic
1141254325 16:82386560-82386582 GTGAAGCAGGGGAGGCTGCCTGG + Intergenic
1141664856 16:85460800-85460822 GAGAAGGAGCTGAGGAAGCCAGG + Intergenic
1141701798 16:85645737-85645759 CAGAAGTCGGGCAGGATGCCGGG + Intronic
1141899789 16:86983719-86983741 GGGAAGCAGGGGTGGAGGCTGGG + Intergenic
1142447576 16:90151381-90151403 GCGAAGTCAGCGAGGAGGCCAGG + Intergenic
1203143383 16_KI270728v1_random:1783714-1783736 GAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1203143413 16_KI270728v1_random:1783811-1783833 GAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1142459917 17:83942-83964 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
1142708538 17:1710771-1710793 GGGAAGTGGGGGCGGCGGCCAGG - Intergenic
1142717721 17:1756030-1756052 GTGAAGTGGGGGAGGGGGCGGGG + Intergenic
1142781625 17:2185750-2185772 GAGAAGACGGGGACGAGGGCAGG + Intronic
1142781720 17:2186452-2186474 GAGAGGAGGGGGAAGAGGCCTGG + Intronic
1142958113 17:3535043-3535065 GGGCAGGAGGGGAGGAGGCTGGG - Intronic
1143391485 17:6561511-6561533 GAGGAGGAGGGGAGGAGGAGGGG - Intergenic
1143590862 17:7885273-7885295 GCGGGGGAGGGGAGGAGGCCTGG - Intronic
1143863570 17:9908292-9908314 GACAAGTAGGTGAGGAGGTGGGG + Intergenic
1144098312 17:11921514-11921536 AAGCAGTAGGGGTGGAGGCATGG + Intronic
1144126786 17:12210408-12210430 GAGAAGAAGAGGAGGAGGAGAGG - Intergenic
1144224908 17:13135786-13135808 GAGAAGGAGGAGTGGAGCCCAGG + Intergenic
1144670539 17:17130371-17130393 GGGAGGGAGGGGAGGAGGACAGG - Intronic
1144872066 17:18377823-18377845 GTGAAGGAGGGCAGGAGGGCAGG - Exonic
1146460088 17:33039340-33039362 GTGAGGAAAGGGAGGAGGCCAGG - Intronic
1146617862 17:34370860-34370882 GAGAAGAAGGCCAGGAGGCCAGG - Intergenic
1146674159 17:34761357-34761379 GAGAGGTAGGGGAGGGAGACAGG + Intergenic
1146686394 17:34844272-34844294 GAGAAGTGGGGTGGGAGGCTGGG + Intergenic
1146912659 17:36658386-36658408 GAGGAGTAGAGGAGGTGACCTGG - Intergenic
1146929891 17:36769408-36769430 GAGAAGTCGGGGAGGAGAGGGGG - Intergenic
1146930489 17:36774080-36774102 GACAAGTAGGGGAGGATGCAGGG - Intergenic
1147337533 17:39736711-39736733 AAGAAGTGGGGGAGGAGGCAAGG - Intergenic
1147374984 17:40017895-40017917 GGGAGGTCGGGGAGGAGGTCTGG + Intergenic
1147456121 17:40539242-40539264 GAGAAGGAGGGAAGGAGGGAAGG - Intergenic
1147499160 17:40945664-40945686 GAGAAGGTGAGGAGGAGGGCAGG + Intergenic
1147583584 17:41639800-41639822 GAGGACCAGGGGAGGAGGACTGG + Intergenic
1147742022 17:42675245-42675267 GGGAGGTGGGGGAGGGGGCCAGG + Intronic
1149324800 17:55519130-55519152 GAGAAGTAGGGTAGGAGTGCTGG + Intergenic
1149521110 17:57318901-57318923 GAGAAGCAGGGAAGCAGGCTAGG + Intronic
1149766099 17:59279957-59279979 AAAAAGTGGGGGAGGAGGCGTGG - Intergenic
1149866631 17:60154729-60154751 GAGGGGCAGGGGAGGAAGCCTGG + Intronic
1150004929 17:61463568-61463590 GAGAAGGAGAGGGGAAGGCCAGG + Intronic
1150124448 17:62627531-62627553 GAGGGGAAGGGGAGGAGGCGCGG - Exonic
1150263323 17:63814586-63814608 GAGAGGTAGGGCAGCAGGCTTGG - Intronic
1150292334 17:63988881-63988903 GAGGAGTGCGGCAGGAGGCCGGG - Intergenic
1150343523 17:64387282-64387304 GAGAAGTGGGGCCTGAGGCCAGG + Intronic
1150364855 17:64573201-64573223 GAGGAGGAGGGGAGGAGGAGGGG + Intronic
1150453283 17:65287278-65287300 GAGAAGGAGGGGCAGAGGGCAGG + Intergenic
1150561903 17:66302288-66302310 GGGATGCGGGGGAGGAGGCCGGG - Intergenic
1150583648 17:66498156-66498178 GAGAAGTATGGAAAGTGGCCGGG - Intronic
1150643773 17:66965715-66965737 CAGAAGTAGGGGCGGGGGCGCGG + Intronic
1151351377 17:73534068-73534090 GAAGAGGAGGGGAGGAGGCGGGG - Intronic
1151351908 17:73536826-73536848 GCGGAGTAGGGAAGGAGGCGGGG - Intronic
1151477081 17:74350312-74350334 GAAAAGGAGGGGAGGGGCCCAGG + Intronic
1151653260 17:75483166-75483188 GAGGAGCAGGAAAGGAGGCCAGG + Intronic
1151718664 17:75843952-75843974 GAGGAGTAGGGGATGGGGTCAGG + Intronic
1152076142 17:78161161-78161183 CAGAAGTAGGTGAGCAGGTCTGG - Exonic
1152627813 17:81396297-81396319 GAGAAGTGGGGGTGGAGGAGGGG + Intronic
1152728043 17:81957304-81957326 GAGAGGAAGGGGAGGAGGAAGGG - Intronic
1152763610 17:82122764-82122786 GAGAAGTCCTGGAGGAGGCAGGG - Intronic
1153530800 18:6043451-6043473 GAGCAGCAGGTGATGAGGCCTGG - Intronic
1153543034 18:6177440-6177462 GAGAAGGATGGGAGCAGGACTGG + Intronic
1153645788 18:7194958-7194980 TAGAAATAGAGGAGGAGGCTGGG - Intergenic
1153924425 18:9823243-9823265 GGGAAGTAGGGGTGGGGGACGGG + Intronic
1154032230 18:10763830-10763852 GGGAAGATGGGGAGGAGGCGCGG + Intronic
1154051285 18:10961410-10961432 GGGAAGTGTGGGAGGAGGCAAGG + Intronic
1154092406 18:11378110-11378132 GAGAAGGAGGGCACCAGGCCTGG + Intergenic
1154294610 18:13137469-13137491 GCGCAGGTGGGGAGGAGGCCCGG + Intergenic
1154472857 18:14721872-14721894 GAGAAGCAAGGGAGGAGGCCAGG + Intergenic
1155243344 18:23884309-23884331 GAAAAGTTGGTGGGGAGGCCAGG - Intronic
1156116750 18:33794789-33794811 GATAAAGAGGGGAGGAGGCCAGG - Intergenic
1156313618 18:35947708-35947730 GAGAAGAAAGAGAGGAGTCCAGG + Intergenic
1156891774 18:42198571-42198593 GAAAAGTGGGGAAGGAGGCAGGG + Intergenic
1157471221 18:47990645-47990667 GAGAAGAAAGAGAGGAGGCCAGG + Intergenic
1157577277 18:48751786-48751808 GAGAAGTTGGGGTGGAGGCAGGG - Intronic
1157656332 18:49393042-49393064 GAGGAGGAGGGGAGGAGGGGAGG + Intronic
1157710117 18:49844272-49844294 GAGAACTAGGGGGAAAGGCCTGG + Intronic
1158866626 18:61643920-61643942 CAGAAGTAGGGAAGCAGTCCCGG + Intergenic
1160316391 18:77851753-77851775 GAGAAGGAGGGAAGGAGGGAAGG - Intergenic
1160649632 19:216450-216472 GCGAAGTCAGCGAGGAGGCCAGG - Intergenic
1160688106 19:446669-446691 CAGAAGATGGGGAGGAGCCCTGG + Intronic
1160904461 19:1445926-1445948 GAGGCGGCGGGGAGGAGGCCGGG - Intergenic
1161030286 19:2054934-2054956 GAGGAGGAGGAGAGGAAGCCAGG - Intergenic
1161195404 19:2983618-2983640 GAGGAGGAGGGGGGGAGGGCAGG + Intronic
1161440958 19:4291410-4291432 CAGAAGTAGGGGAGGGGAGCTGG + Intergenic
1161454427 19:4363006-4363028 GGGAATTGGGGGAGGAGGCAGGG - Intronic
1161702697 19:5804169-5804191 GAGCCGTCGGGGAGGAGCCCGGG + Intergenic
1161743058 19:6036347-6036369 GAGAAGAGAGGGAGGAGGCATGG + Intronic
1161955918 19:7495044-7495066 GAGAAGGAGGGAAGGAAGCAGGG - Intronic
1162054123 19:8052679-8052701 GAGGAGGAAGGGAGGAGGGCGGG + Intronic
1162438484 19:10678249-10678271 GAGAACATGGGGAGGAGGCAAGG + Intronic
1162614650 19:11788270-11788292 GAAAAATAGAGGAGGAGGCCAGG + Intergenic
1162651369 19:12091509-12091531 CAGGAGTAGGGGATGAGGCATGG - Intergenic
1162937188 19:13987106-13987128 GAGAAGCAGGGAAGAAGGGCCGG + Intronic
1163052106 19:14692219-14692241 GAGAACTTGGGGAGGATGTCAGG + Intronic
1163106811 19:15128090-15128112 AAGACGTAGAGGAGGAGGGCCGG - Intergenic
1163566060 19:18052028-18052050 GAGGACTCGGGGAGGAAGCCTGG + Intergenic
1163686650 19:18715654-18715676 GAGAAGCAGGGGAAGAGGGGAGG - Intronic
1163786763 19:19278835-19278857 AGGAAGGAGGGGAGCAGGCCTGG + Intronic
1163795920 19:19337950-19337972 CAGAAGTATGGGTGGAGCCCAGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164234778 19:23322808-23322830 GAGAAGTGGAGGAGGAGGTGGGG - Intronic
1164234786 19:23322831-23322853 GAGAAGTGGAGGAGGAGGTGGGG - Intronic
1164234794 19:23322854-23322876 GAGAAGTGGAGGAGGAGGTGGGG - Intronic
1164234802 19:23322877-23322899 GAGAAGTGGAGGAGGAGGTGGGG - Intronic
1164249982 19:23467898-23467920 GAAAAGGAGGGGAGGAGGAGAGG - Intergenic
1164249998 19:23467970-23467992 GAGAAGTGGAGGAGGAGGATGGG - Intergenic
1164292446 19:23880384-23880406 GAGAAGGAGAGGAGGAGGAGAGG + Intergenic
1164292453 19:23880420-23880442 AAGAAGTAGAGGAGGAGGAGAGG + Intergenic
1164463518 19:28468410-28468432 GAGAAGGAGGGGAGAAGGAGGGG + Intergenic
1164577004 19:29411371-29411393 GAGGAGTGGGGGAGGAGGGAAGG - Intergenic
1164581644 19:29438748-29438770 GAGAAGGAGGGGAGAAGGGGAGG + Intergenic
1164614924 19:29661629-29661651 GAGATGTAGGGGAGGCGGGGGGG - Intergenic
1165140723 19:33698554-33698576 GACAAGGAGGTGAGGAGGGCGGG + Intronic
1165152117 19:33766986-33767008 GAGAACTGGGGAAGGAGGGCAGG - Intronic
1165207790 19:34205685-34205707 GAAAAGTTGGTGAGGACGCCAGG + Intronic
1165253406 19:34558184-34558206 GAGATGTAGTTGAGGAGGCAAGG + Intergenic
1165340397 19:35207384-35207406 GAAAAGTACTGTAGGAGGCCAGG + Intergenic
1165488030 19:36107166-36107188 GAGCAGGAGAGGAAGAGGCCAGG - Intergenic
1165666324 19:37631937-37631959 AAGAACTAGGTGAGGAGGGCTGG - Exonic
1165757704 19:38304063-38304085 GAGAAGTGGGGGAGATGGACAGG - Intronic
1166158337 19:40932515-40932537 TAGAAGTAGGGATGGTGGCCGGG + Intergenic
1166341585 19:42140553-42140575 GAGAGGAAGGGGAGGAGGTGGGG - Intronic
1166661140 19:44647872-44647894 GGGAAGGAAGGGAGGAGGCCTGG + Intronic
1166852044 19:45765778-45765800 GGGAAGTTGGGCAGGAGGCCAGG + Exonic
1166852904 19:45768898-45768920 GACAGGTGGGGGAGGAGGCTGGG - Exonic
1166996467 19:46721929-46721951 GAGAAGGGGAGGAAGAGGCCTGG - Intronic
1167155632 19:47736934-47736956 AAGAAGTTGGGAAGGGGGCCAGG + Intronic
1167158989 19:47755549-47755571 GAGAGGCTGGGGAGGGGGCCGGG + Intronic
1167483717 19:49748002-49748024 GAGAAAGAGGGGAGGAGGCTGGG - Intronic
1167650953 19:50728346-50728368 TAGAACAAGGGCAGGAGGCCTGG + Intergenic
1167731969 19:51265064-51265086 GAGAAGCAGAGTAGGAGGTCTGG + Intronic
1167786888 19:51644534-51644556 GAGAAGTGGGATAGGAGGCAGGG + Intronic
1168686941 19:58354485-58354507 GAGAAGGAGCAGAGGAGACCAGG + Exonic
1202646242 1_KI270706v1_random:144648-144670 GAGAAGTAGGGAAGGAGGCCAGG - Intergenic
925070583 2:964543-964565 GAGAAGGATGGGAGGAGGAAGGG + Intronic
925110330 2:1330050-1330072 GGAAAGGAGGAGAGGAGGCCAGG + Intronic
925139298 2:1538960-1538982 GACACGCAGGGGAGAAGGCCGGG - Intronic
925907279 2:8547041-8547063 GAGAGGAAGTGGGGGAGGCCTGG - Intergenic
925942925 2:8837402-8837424 GAGGAGTCGGGGGCGAGGCCGGG - Intronic
926141514 2:10371113-10371135 GAGCAGCAGGGGTGGAGCCCTGG + Intronic
926247489 2:11131917-11131939 GAGATGTGGGGGAGGAGACAAGG - Intergenic
926796694 2:16625415-16625437 GTGAAGTGGGGGAGGAGGGAAGG + Intronic
928301548 2:30129778-30129800 GAGAGGGAGGGAAGGAGGACTGG - Intergenic
928453755 2:31401065-31401087 GAGGAGATGGGGAGGTGGCCAGG + Intronic
928549438 2:32357017-32357039 GAGAAGCAGGGAGGGAGGCGGGG - Exonic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
929041810 2:37751596-37751618 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
929072076 2:38041256-38041278 AAGTAGTAGGAGAGGAGGGCAGG - Intronic
929112932 2:38420565-38420587 AAGAAGTTGGGAAAGAGGCCGGG + Intergenic
929588427 2:43130403-43130425 GGGATGCAGAGGAGGAGGCCAGG + Intergenic
929983106 2:46699218-46699240 GTGAAGAAGGGGAGGCGGCAGGG + Intronic
930753245 2:54952191-54952213 CAGAAGTAGGGGTGGAGGCCTGG - Intronic
931129524 2:59318477-59318499 AAGGAGGAGGGGAGGAGGCTGGG + Intergenic
931719449 2:65056613-65056635 GAGACGCGGGGGAGGGGGCCGGG - Intronic
932379039 2:71265248-71265270 GGGAAGGAGGGGAGGAGGGAAGG - Intergenic
932586029 2:73029601-73029623 GAGACCTAGGTGAGGAGGCCTGG - Intronic
932891585 2:75601454-75601476 CAGAAGCCAGGGAGGAGGCCGGG + Intergenic
932938090 2:76129923-76129945 AAAGAGAAGGGGAGGAGGCCTGG + Intergenic
934509380 2:94925075-94925097 AGAAGGTAGGGGAGGAGGCCAGG - Intergenic
934551885 2:95267781-95267803 AAGAAGTGGGGGAGAAGGCAGGG + Intergenic
934692319 2:96371186-96371208 GAGAAGTGTCGGGGGAGGCCTGG + Intronic
934771975 2:96912951-96912973 GAGAACTGGGGGAGGAAGCTTGG + Intronic
935066509 2:99652925-99652947 GAGAGGCAGGGGAAGAGGACCGG + Intronic
935312830 2:101802445-101802467 TAGAAGGAGGAGAGGAGGGCTGG - Intronic
935755533 2:106273543-106273565 CAGAAGGTGGTGAGGAGGCCTGG - Intergenic
935842283 2:107126723-107126745 AAGAAGTAAAGGAAGAGGCCGGG - Intergenic
936972045 2:118185589-118185611 GAGAGGTGGGGCAGGAGCCCGGG + Intergenic
937172907 2:119895104-119895126 GAGAATGAGGGAAGGAGGCAGGG + Intronic
937303778 2:120858731-120858753 GAGATGTGGGGCAGGAGGCTGGG + Intronic
937419245 2:121740810-121740832 GGGAAGGAGGAGAGGGGGCCTGG - Intronic
937713899 2:125010240-125010262 AGGAATTAGGGGAGGAGGACTGG + Intergenic
937920098 2:127122719-127122741 GAGAAGCAGAGGAGGAGAGCTGG + Intergenic
937988464 2:127649314-127649336 CAGCAGGAGGGGAGGAGGCACGG - Intronic
938097455 2:128473090-128473112 GGGAAGGAGGGGAGGAGGAAGGG - Intergenic
938292470 2:130157404-130157426 GAGAAGGAGGGGTGAGGGCCTGG + Intronic
938307901 2:130267141-130267163 GAGAGGTAAGCGTGGAGGCCTGG - Intergenic
938414720 2:131094436-131094458 GTGATGGAAGGGAGGAGGCCTGG + Intergenic
938464084 2:131515572-131515594 GAGAAGGAGGGGTGAGGGCCTGG - Intergenic
938938887 2:136151840-136151862 AAGAAGTAGGTAAGGAGTCCAGG - Intergenic
939095915 2:137833222-137833244 TAGAAGTAAGGGAGGAGGCAGGG - Intergenic
940300548 2:152172571-152172593 GAGAAGGGGGGGAGGAGGCTGGG + Intronic
940353839 2:152717922-152717944 GAGGCGGAGGGGAGGAGGCGGGG + Exonic
940517596 2:154699555-154699577 TAGAACCAGGGGAGGGGGCCCGG - Intronic
940777264 2:157898062-157898084 GAAAAGGAAGGAAGGAGGCCAGG + Intronic
941670379 2:168286217-168286239 GTAAAGAAAGGGAGGAGGCCAGG - Intergenic
942086775 2:172451175-172451197 TAAAAATAGGGAAGGAGGCCGGG + Intronic
942246456 2:174013067-174013089 GCGCGGGAGGGGAGGAGGCCGGG - Intergenic
942367333 2:175241316-175241338 GAGAAGCAGGGGAGGAGTTCTGG - Intergenic
942454894 2:176130681-176130703 GAGGAGGAGGGGGGGCGGCCTGG - Exonic
942455597 2:176136336-176136358 GAGAAGGAAGAGAGGAGGCGGGG + Intergenic
942496033 2:176541058-176541080 GAGGAGGAGGGGAGGAGGGGAGG + Intergenic
942496057 2:176541102-176541124 GAGGAGGAGGGGAGGAGGGGAGG + Intergenic
942609503 2:177728230-177728252 GATAAGCAGGGGAGGAGAGCAGG - Intronic
942690133 2:178576271-178576293 AAAAAGTAGGAGACGAGGCCTGG - Exonic
944105251 2:196072623-196072645 GAGAAGAAAGGTAGGAGGCAGGG + Intergenic
944835936 2:203579883-203579905 GAGAGGGAGAAGAGGAGGCCTGG + Intergenic
946299549 2:218814301-218814323 GAGAGGTAGGGGAGAAGGAGTGG + Intronic
947619022 2:231576749-231576771 GGGAAGCAGGGGAGGAGGAGGGG - Intergenic
947906960 2:233771815-233771837 GAGAAGGAGGGAAGGAAGCAAGG - Intronic
948151013 2:235744668-235744690 GAGAAGAAGGGGAGGAGAGCAGG - Intronic
948315666 2:237026730-237026752 AAGAAGGAGGCCAGGAGGCCAGG + Intergenic
948483327 2:238264026-238264048 AAGAAGGAGGGGAGGAGGAGGGG + Intronic
948707759 2:239805690-239805712 GAGAGCTCGGAGAGGAGGCCCGG - Intergenic
948748212 2:240110805-240110827 GAGGAGGAGGGGAGGAGGAGAGG - Intergenic
948748226 2:240110851-240110873 GAGGAGGAGGGGAGGAGGAGAGG - Intergenic
1168857167 20:1016786-1016808 GGGAAGTGGGGAAGGAGGCTGGG - Intergenic
1168966460 20:1901464-1901486 TAGAAATACGAGAGGAGGCCGGG - Intronic
1169221718 20:3827060-3827082 GAGAAGAAAGGGAAGAGGCTTGG - Exonic
1169273441 20:4217694-4217716 GAGAAGGCGGGGAGGAGACCAGG + Intergenic
1169912201 20:10656012-10656034 GAAAAGTCGGGGAGGGGGCTGGG + Intronic
1170501790 20:16982358-16982380 GAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1170691481 20:18619718-18619740 TAAAAGCAGGAGAGGAGGCCAGG - Intronic
1171128365 20:22624666-22624688 GGGAAGTAGGGAGGGAGGGCAGG - Intergenic
1171235888 20:23524318-23524340 GGAAAGTAGGGCAGGTGGCCTGG - Intergenic
1171486246 20:25488517-25488539 GAGAATGAGTGAAGGAGGCCGGG - Intronic
1171986054 20:31661956-31661978 TAGAAGCAGTGGAGGAGGACTGG - Intergenic
1172285012 20:33734144-33734166 GAGATCTAGGGGAGGAGGGCAGG + Intronic
1172468096 20:35172017-35172039 GAGGAGGATGGAAGGAGGCCAGG - Intergenic
1172578260 20:36026326-36026348 CCGAAGTGGGGGTGGAGGCCAGG - Intronic
1173145451 20:40520537-40520559 GAGAAGTAGGGAAGGAGGTACGG - Intergenic
1173254931 20:41387530-41387552 GAGGAGTAGGGGAGGATGCTCGG - Intergenic
1173373702 20:42462925-42462947 GTGAAGTAGTGGATGAAGCCTGG + Intronic
1173522724 20:43711578-43711600 GAGAAGCAGAAGAGGAAGCCTGG + Exonic
1173555128 20:43960550-43960572 GGGAAGTGGGGGAGCAGGACAGG - Intronic
1173865324 20:46308935-46308957 GAGGAGCAGGGGCGCAGGCCAGG + Intergenic
1174110119 20:48193206-48193228 GGGCAGGAGGGGATGAGGCCAGG - Intergenic
1174120952 20:48265099-48265121 GGGAAACAGGTGAGGAGGCCAGG + Intergenic
1174129136 20:48329340-48329362 GAGAAGGAGGGAAGGAGGGAGGG + Intergenic
1174398265 20:50261148-50261170 GACATGAAGGGGAAGAGGCCAGG - Intergenic
1174442002 20:50563215-50563237 TAGGAGTAGGGGAGGAGGATAGG - Intronic
1174550331 20:51357300-51357322 GAGCAGGAGGGGATGAGGTCAGG - Intergenic
1174566224 20:51466352-51466374 TAGAATTAGGGAGGGAGGCCCGG - Intronic
1174695149 20:52549665-52549687 GGGAAGTATAGTAGGAGGCCGGG + Intergenic
1174795846 20:53522038-53522060 GAGAAGGAGGGAAGGAGGGAAGG + Intergenic
1175271176 20:57735127-57735149 GAGAGGGAGGGGAGGAGATCTGG - Intergenic
1175359255 20:58395031-58395053 GAAAATTAGGGGAGGAGTCAAGG + Intronic
1175380760 20:58561448-58561470 GAGAAGTAGGGGGAGAGGGCAGG + Intergenic
1175402968 20:58711081-58711103 GAGGAGGAGGAGAGGAGGCGGGG - Intronic
1175499854 20:59442077-59442099 GAGAAGGAGGGAGGGAGGCAGGG - Intergenic
1175674568 20:60935637-60935659 GAGAAGGAGGAGAGGAGGGAAGG - Intergenic
1175730964 20:61353683-61353705 GAGGAGGAGGGGAGGAGGAGGGG - Intronic
1175763695 20:61578646-61578668 GAGATGGAGGAGAGGTGGCCAGG - Intronic
1175954966 20:62604556-62604578 CAGACCTTGGGGAGGAGGCCTGG - Intergenic
1176031907 20:63016908-63016930 GGGAAGGAGGAGGGGAGGCCTGG + Intergenic
1176174034 20:63709340-63709362 AAGAAGCATGGAAGGAGGCCAGG + Intronic
1176605632 21:8828113-8828135 GAGAAGTAGGGAAGGAGGCCAGG + Intergenic
1176801627 21:13435977-13435999 GAGAAGCAGGGGAGGAGGCCAGG - Intergenic
1176846712 21:13882208-13882230 GAGCACTAGGGTATGAGGCCTGG + Intergenic
1177368276 21:20167711-20167733 GAGAAGCAGGGGAAGGTGCCAGG + Intergenic
1177713285 21:24807556-24807578 GAGAAGTAGGGAAGAAGAACTGG + Intergenic
1179030033 21:37712489-37712511 GAGGAGAAGGGGAGGAGGGAGGG - Intronic
1179030053 21:37712548-37712570 GAGGAGAAGGGGAGGAGGGAGGG - Intronic
1179030066 21:37712593-37712615 GAGGAGGAGGGGAGGAGGGAGGG - Intronic
1179030079 21:37712629-37712651 GAGGAGAAGGGGAGGAGGGAGGG - Intronic
1179891639 21:44338689-44338711 GTGAGGGAGGGGAGGAGGCCGGG - Intronic
1180058854 21:45374557-45374579 GAGGGGCAGGGGAGGAGGCAGGG - Intergenic
1180081538 21:45489871-45489893 GGGAAGTCGGGGAGGAGGTGTGG - Intronic
1180081556 21:45489915-45489937 GGGAAGTCGGGGAGGAGGTGTGG - Intronic
1180347929 22:11719717-11719739 GAGAAGTAGGGAAGGAGGCCAGG + Intergenic
1180355707 22:11837819-11837841 GAGAAGTAGGGAAGGAGGCCAGG + Intergenic
1180382546 22:12154506-12154528 GAGAAGTAGGGAAGGAGGCCAGG - Intergenic
1180617294 22:17136741-17136763 AAGAATGAGGGAAGGAGGCCGGG + Intergenic
1181457442 22:23067682-23067704 GAGCAGTTGGGGAGGTGGTCAGG - Intronic
1181959484 22:26612646-26612668 CAGAATTAGGGCATGAGGCCAGG - Intronic
1182422093 22:30253698-30253720 GAGGGGAAGGAGAGGAGGCCAGG - Intergenic
1182458216 22:30466093-30466115 GAGAAATAAGGGAGGATCCCTGG + Intronic
1182501781 22:30753311-30753333 GAGATGGAGGTGAGGAGGGCAGG + Intronic
1182578841 22:31291639-31291661 GAGATGGAGAGGAGGAGGCCTGG + Intronic
1182655264 22:31885064-31885086 AAGGAGCAGGGGAGGAAGCCAGG - Intronic
1183018052 22:35006259-35006281 GAGAAGGGGGTGAGGAGGCAGGG - Intergenic
1183026866 22:35071842-35071864 GAGAAGTGAGGGAGGAGGAGAGG - Intronic
1183037508 22:35151291-35151313 GAGAAGCGGGCCAGGAGGCCAGG - Intergenic
1183082046 22:35462983-35463005 GAGGAGAAGGGAAGGAGGGCAGG - Intergenic
1183104524 22:35606622-35606644 GAGGAGAAGGGGAGGAGGAAAGG - Intergenic
1183108357 22:35630344-35630366 GAGGAGGAGGGGAGGAGGAGGGG + Intronic
1183482414 22:38072385-38072407 GAGAAGCAGGGCAGGGGGCCTGG - Intronic
1183690365 22:39384659-39384681 GAGAAGTAGGGGAGGGCAGCTGG - Exonic
1183782497 22:40007718-40007740 GAGGAGGAGAGGAGGAGGACAGG - Intronic
1184088284 22:42279100-42279122 GAGCCCTAGGGGAGGAGGCTGGG - Intronic
1184094549 22:42309475-42309497 GAGCAGTAAAGGAGGAGGCTGGG - Intronic
1184269139 22:43368459-43368481 CAAAAGTAGTGGAGGAGGGCTGG - Intergenic
1184943481 22:47784905-47784927 GGGAAGCAGGGGAGGGTGCCAGG + Intergenic
1185004741 22:48269058-48269080 AAGAAGGAGGGAGGGAGGCCCGG + Intergenic
1185181358 22:49365318-49365340 GAGGAGCAGGGGCTGAGGCCAGG + Intergenic
1185234443 22:49704041-49704063 GAGAAGAAGGGGTGCAGCCCAGG + Intergenic
1185398334 22:50603748-50603770 GGGAAGCGGGGGAGGAGGGCAGG + Intronic
1203294027 22_KI270736v1_random:23116-23138 GAGAAGTTGGAGAGGTGGCCAGG - Intergenic
950176470 3:10878213-10878235 GAGTAGTAGGGGACGCAGCCAGG - Intronic
950365453 3:12480334-12480356 GAGGAGGAGAGGAGGAGGGCAGG - Intergenic
950523345 3:13509212-13509234 GGTGAGGAGGGGAGGAGGCCGGG - Intergenic
950565733 3:13768532-13768554 GAGGAGTTGGGGAGGAAGGCCGG + Intergenic
950609208 3:14114480-14114502 GAGATGTAGGGGAAGGGGCATGG - Intronic
950695927 3:14701187-14701209 GAGAAGTGGGGGAAGTGACCAGG + Intronic
950722284 3:14891873-14891895 GAGAAGGAGGGAAGGAGGAAGGG - Intronic
951214521 3:20011204-20011226 GAGAAGTAGGGGAAGAAACTGGG + Intronic
951595286 3:24312105-24312127 GGGAAGTAGGGCAGAAGGCAAGG - Intronic
951706298 3:25547269-25547291 GAGAGGTAGAGAAAGAGGCCAGG + Intronic
952029303 3:29121300-29121322 GAGAAGGAGGGAGGGAGGCAGGG + Intergenic
952870839 3:37899649-37899671 GAGAAGAAAGTGAGGAGGCCAGG + Intronic
952990014 3:38823786-38823808 GAGAGGTCGAGGAGGAGCCCAGG + Intergenic
953305161 3:41822215-41822237 GAGAAGTGAGGAAGGAGGCAGGG - Intronic
953366678 3:42351312-42351334 GAGGAGGAGGGCAGGAAGCCAGG + Intergenic
953449660 3:42995728-42995750 GAGAAGAAGGGGAGGGGAGCAGG - Intronic
953567385 3:44044557-44044579 AAAAAGTAAGGAAGGAGGCCAGG + Intergenic
953871324 3:46629803-46629825 GAGGAGGAGGGGAAGAGGCGGGG + Intergenic
954368307 3:50157394-50157416 GAGAAGGAGGGAAGGAAGGCTGG - Intronic
954688208 3:52382064-52382086 GATTACTAGGGGAGGTGGCCAGG + Intronic
955366574 3:58315373-58315395 GAGGAGTAGGGGAGGAGGGGTGG + Intronic
955399122 3:58578772-58578794 GTAAAGTTGGGGTGGAGGCCTGG - Intronic
955741543 3:62096086-62096108 GAGAAGTAGGGGAGGACACATGG + Intronic
956008727 3:64807917-64807939 AAGAAATAGGGGAGGAGCACAGG - Intergenic
956184951 3:66553519-66553541 GCGAATGAGGGAAGGAGGCCAGG + Intergenic
956248008 3:67205470-67205492 GAGAAGTAGGGGTGGGGGTTGGG - Intergenic
956535214 3:70267998-70268020 GAGAAGGAGGGGAGGAGAAAGGG - Intergenic
957060264 3:75475716-75475738 GAGGAGAAGAGGAGGAGGCAAGG + Intergenic
960248346 3:115424722-115424744 GAGAAGAAGGGAAGGAGGAGAGG - Intergenic
960884973 3:122384321-122384343 GGGAGGTAGGGGAGCTGGCCCGG + Intronic
960891470 3:122452669-122452691 GAGAAGGAGGGAAGGAGGGAGGG + Intronic
960957574 3:123044848-123044870 AAGATGAAGGGGAGGAGGCAGGG - Intergenic
961035267 3:123637696-123637718 AAGAAGGAGGGCAGGAGGCCAGG - Intronic
961293125 3:125863695-125863717 GAGGAGAAGAGGAGGAGGCAAGG - Intergenic
961381489 3:126498886-126498908 GACAAGCAGGGGATGAGGGCGGG - Intronic
961532387 3:127547527-127547549 GAGGGGTAGGGGAGTAAGCCAGG + Intergenic
961658983 3:128458368-128458390 AAGAGGGAAGGGAGGAGGCCAGG + Intergenic
962204581 3:133424361-133424383 TAGAAGTAGAAGAGAAGGCCGGG - Intronic
962388982 3:134956082-134956104 GGGAGGAAGGGGAGGAGGCTGGG + Intronic
962751207 3:138435668-138435690 GGGAGGGAGGGAAGGAGGCCCGG - Intronic
963272965 3:143303389-143303411 GGGAAGGAGGGAAGGAGGCAAGG + Intronic
963734180 3:149001491-149001513 GAGAAATAGAGGAGGAGGAAGGG + Intronic
963776006 3:149441160-149441182 GAGAAGGAGGGAAGGAGGGATGG + Intergenic
964016630 3:151955455-151955477 GAGATGGAGGGGAGGAAGCTAGG + Intergenic
964102738 3:153006449-153006471 GAAAAGAAGAGGTGGAGGCCGGG - Intergenic
964433700 3:156630956-156630978 GAGAGGTAGGGGTGCTGGCCAGG + Intergenic
964490943 3:157235515-157235537 GAGAAGGAGGCAAGAAGGCCAGG - Intergenic
964531364 3:157671442-157671464 GAGAAGAAGGGAAGGAGGGAGGG - Intronic
965076396 3:163983062-163983084 AAAAAGTAAGGGAGGACGCCAGG + Intergenic
965083880 3:164069444-164069466 GAGAAGGAGGGAAAGAGGGCAGG + Intergenic
965436203 3:168654994-168655016 GAGAGGTCGGGGAGAAGGGCAGG + Intergenic
965984876 3:174738603-174738625 AATAAGTTGGGGAGGAGCCCTGG + Intronic
966594281 3:181712253-181712275 GAGGAGGAGGGGAGGCGGGCGGG - Exonic
966737058 3:183195446-183195468 GAGACGTTGGGGAGGATGCCAGG - Intronic
966762274 3:183428667-183428689 AAGAAGGAGGGGCGGAGACCTGG - Intronic
966853789 3:184180487-184180509 GAGGGGTGGGGGAGGAGGCCTGG + Intronic
966897668 3:184457831-184457853 GTGAAGGAAGGGAGGAGCCCAGG - Intronic
967170430 3:186818827-186818849 GAGAAGTGGGAGAGGATGCCAGG + Intergenic
967965337 3:194956262-194956284 GAGAAGTGGCAGAAGAGGCCTGG - Intergenic
968058816 3:195712976-195712998 GAGACTTAGGGCAGGAGGACTGG - Intergenic
968058825 3:195713007-195713029 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968058858 3:195713125-195713147 GAGACTTAGGGCAGGAGGACTGG - Intergenic
968058962 3:195713475-195713497 GAGACTTAGGGCAGGAGGACTGG - Intergenic
968058971 3:195713506-195713528 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059031 3:195713713-195713735 GAGACTTAGGGCAGGAGGACTGG - Intergenic
968059113 3:195713976-195713998 GAGACTTAGGGCAGGAGGACAGG - Intergenic
968059121 3:195714007-195714029 GAGACTTAGGGCAGGAGGACTGG - Intergenic
968059130 3:195714038-195714060 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059139 3:195714069-195714091 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059165 3:195714158-195714180 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059183 3:195714218-195714240 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059192 3:195714249-195714271 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059201 3:195714280-195714302 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968059217 3:195714342-195714364 GAGACTTAGGGCAGGAGGACCGG - Intergenic
968133922 3:196208350-196208372 GGGAAGCAGGAGAGGAGGCGGGG - Intronic
968263517 3:197344006-197344028 GAGACCTAGGGAAAGAGGCCAGG - Intergenic
968368217 3:198203681-198203703 GCGAAGTCAGCGAGGAGGCCAGG + Intergenic
968661419 4:1800289-1800311 GAGCAGTCGGGGACGATGCCTGG + Intronic
968946584 4:3667750-3667772 GAGAAGTCGGGGAGGAGAGGAGG + Intergenic
969285245 4:6198967-6198989 GAGGAGGTGGGGAGGAGGGCAGG - Intronic
969294380 4:6261145-6261167 AAGAAGTGAGGGAGGAGGCCAGG + Intergenic
969314438 4:6373007-6373029 CAGGAGGAGGTGAGGAGGCCTGG - Intronic
969320890 4:6411845-6411867 GAAAAGTCAGGGTGGAGGCCGGG - Intronic
969411606 4:7032032-7032054 GAGATGTAGGGGCAGAGTCCGGG - Exonic
969454747 4:7294782-7294804 GAGGAGGAGGGGAGGAGGGAGGG - Intronic
969476694 4:7426156-7426178 GAGGAGAAGGTGGGGAGGCCGGG + Intronic
969536269 4:7757677-7757699 GGAAAGTAGGGCAGGAGACCTGG - Intergenic
969632509 4:8346750-8346772 GAGAAGTTGGGGAGGGGTCTCGG + Intergenic
969714609 4:8862118-8862140 GTGGAGAAGGGGCGGAGGCCGGG + Intronic
969986453 4:11216485-11216507 GAAAAGTAGGAGAGAAGACCAGG + Intergenic
970824439 4:20254287-20254309 GACAAGTACTGGAGGATGCCCGG + Intronic
970914919 4:21321736-21321758 GAGAAGTGGGGAAGGAGGGAAGG + Intronic
971168438 4:24208303-24208325 GAGAAGGATGGAAGGAGGCAGGG + Intergenic
971570965 4:28210063-28210085 GAGAAGGAGAGGAGGAGGAGGGG - Intergenic
972318370 4:37948770-37948792 AAGAAGTAAGGGAGGAAGACGGG - Intronic
973372478 4:49262876-49262898 GAGAAGTAGGGAAGGAGGCCAGG - Intergenic
973388525 4:49532265-49532287 GAGAAGTAGGGAAGGAGGCCAGG + Intergenic
973538183 4:51905891-51905913 GAGAAGTTTGAGAGGAGCCCTGG + Intronic
974079000 4:57194085-57194107 GAGAACTGGAGGAGGAAGCCAGG - Intergenic
974374543 4:61059605-61059627 TAGAAGAAGGCGAGGTGGCCAGG - Intergenic
975431364 4:74295188-74295210 GAGAAGAAAGAGAGGAGGCCGGG - Intronic
976081248 4:81357297-81357319 GAGAAGCAGGGAGGGAGGCATGG + Intergenic
978448978 4:108808268-108808290 GAAAATTAGGAGGGGAGGCCGGG + Intergenic
979258149 4:118625448-118625470 GAGAATTGGGGGAGGGAGCCAGG + Intergenic
979258206 4:118625751-118625773 GAGAACTAGGGGAGGAGGCCAGG + Intergenic
979330143 4:119414817-119414839 GAGAACTAGGGGAGGAGGCCAGG - Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
979436693 4:120701672-120701694 GAGAAGGAGGGGAGGAGATAAGG + Intronic
979518733 4:121641634-121641656 GTTAAGTATTGGAGGAGGCCGGG - Intergenic
980448027 4:132937661-132937683 GAGATGTGGTGGTGGAGGCCAGG - Intergenic
980882244 4:138723878-138723900 GAGTGGTAGGGGTGGAAGCCAGG - Intergenic
981233026 4:142380680-142380702 GAGAAGTAGATGAGGAGGTGAGG - Intronic
981310971 4:143297897-143297919 GAAAGGCAGGGGAGGAGTCCAGG - Intergenic
981328941 4:143485369-143485391 GAAAAGTTGGAAAGGAGGCCAGG + Intergenic
981731385 4:147902905-147902927 GAGAAGTGGGAGGGGAGGGCGGG + Intronic
982649791 4:158073244-158073266 GAGAAGGAAGGCAGGAAGCCTGG + Intergenic
982665750 4:158260253-158260275 GAGAAGAAGGGAAGGAGGGAAGG - Intergenic
982781740 4:159498384-159498406 GAGAAGTGGGGGAGGGGGAGTGG + Intergenic
983712187 4:170732027-170732049 CAGAAGTGAGGGAGGAGGCAAGG - Intergenic
983819143 4:172171531-172171553 AAGATGTAGGGCAGGAGGCTAGG + Intronic
984402066 4:179279010-179279032 GAGAAAGAGGAGAGGAGGCAAGG - Intergenic
984758584 4:183345092-183345114 GAGCAGGAGGCCAGGAGGCCGGG - Intergenic
984821938 4:183889748-183889770 TAGAAAGAGGGGAGGTGGCCTGG - Intronic
984908411 4:184649876-184649898 GGGAAGAAGAGGAGCAGGCCGGG + Exonic
985387204 4:189460745-189460767 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387214 4:189460799-189460821 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387224 4:189460853-189460875 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387233 4:189460907-189460929 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387243 4:189460961-189460983 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387252 4:189461015-189461037 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387262 4:189461069-189461091 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387272 4:189461123-189461145 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387282 4:189461177-189461199 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387292 4:189461231-189461253 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985387301 4:189461285-189461307 GAGAAGAAGGGAAGGAAGACAGG + Intergenic
985663626 5:1169860-1169882 GGGAAGGAGGGGAGGAGGGAAGG + Intergenic
985995833 5:3596391-3596413 GAGGAGAAGCGGGGGAGGCCGGG - Intronic
986276737 5:6281726-6281748 GAGAAGTGGGGGCGGAGGGGTGG + Intergenic
986609331 5:9551252-9551274 CAGAAGTAGGAGAGAAGGACAGG - Intergenic
986619537 5:9658028-9658050 GGGATGAAGGGGAGGAGCCCTGG - Intronic
986736853 5:10674389-10674411 GAGGAGATGGAGAGGAGGCCAGG - Intergenic
987039208 5:14046134-14046156 GAGAAGTAGGGCAGGTGGAGAGG - Intergenic
991312148 5:65255530-65255552 GAGGAGCAGGGGAGGAGATCCGG + Intronic
991718475 5:69473836-69473858 GAGAGGGAGAAGAGGAGGCCTGG + Intergenic
992089317 5:73303457-73303479 GAGGGGGAGGGGAGGGGGCCTGG + Intergenic
992237563 5:74727474-74727496 TAGAAGTTGGGGAGTAGGGCTGG - Intronic
992542198 5:77776275-77776297 GAGAAGGAGGGGCGGAGAGCCGG + Exonic
992660790 5:78958749-78958771 AATAAGAAGGGGAGGAGTCCTGG - Intronic
993379596 5:87191375-87191397 GAAAAGCAGGGAAGGAGGACAGG + Intergenic
993502975 5:88682825-88682847 GTGAAGTAAGGGAGGAGACAAGG + Intergenic
993956988 5:94246393-94246415 GAGAAGGAGTGGAGGAGACCTGG - Intronic
994596406 5:101843240-101843262 GGGAAGTAGGGAAGGAGGGAGGG + Intergenic
995166799 5:109053089-109053111 GAAAAGTAATGGAGGCGGCCGGG + Intronic
996651218 5:125879476-125879498 GAGAAGGAAGGGAGGAGGTTGGG - Intergenic
997229797 5:132234108-132234130 GAGTAGGAGTGGAGGAGGCTGGG - Intronic
998002204 5:138634251-138634273 AGGAAAGAGGGGAGGAGGCCGGG + Intronic
998124241 5:139605691-139605713 GAGAGGGAGGGGAGGAGGAGGGG - Intronic
998136236 5:139676136-139676158 GAGGAGGTGGGGAGGAGGCTGGG - Intronic
998208502 5:140175975-140175997 GAGAAGGAGGGGAGGACCCCTGG + Intronic
999145719 5:149391953-149391975 GAGAAGCTGGGGAAGAGGGCAGG - Intronic
999325725 5:150642300-150642322 GAGAGGAAGGGGTGGAGGGCGGG - Intronic
1000267717 5:159653726-159653748 GAGAAGTAGAGGAGAAGCCTTGG + Intergenic
1000552147 5:162680217-162680239 GAGAGGGAGAAGAGGAGGCCTGG + Intergenic
1001292202 5:170471706-170471728 GAGAAGAGAGGGAGGAGGCAGGG - Intronic
1001335886 5:170796109-170796131 GAGGCCTTGGGGAGGAGGCCAGG + Intronic
1001514519 5:172346069-172346091 GAGAAGTAGGAGGTGATGCCTGG + Intronic
1001581130 5:172799265-172799287 GAGAAGGAGAGGATGAGGCCAGG - Intergenic
1001794865 5:174493446-174493468 CAGAAGGAGAGGAGGAGGCCTGG + Intergenic
1001936601 5:175709909-175709931 GTGAAGTGACGGAGGAGGCCTGG - Intergenic
1002371702 5:178760062-178760084 GAGAAGTATCAGAGGCGGCCGGG - Intergenic
1002440036 5:179259462-179259484 GAGAGGAAGGGGAGCAGCCCTGG + Intronic
1002727438 5:181308912-181308934 GCGAAGTCAGCGAGGAGGCCAGG + Intergenic
1002789643 6:427759-427781 GAGAAGTGGGGAAAGATGCCTGG - Intergenic
1002804338 6:557903-557925 GAGAGATGGGGTAGGAGGCCAGG + Intronic
1002898475 6:1392540-1392562 GAGAAGAAGGGGAGCAGGGAGGG - Intronic
1003995742 6:11538016-11538038 AGGAAGGAGGGGAGGGGGCCGGG - Intergenic
1004123990 6:12854345-12854367 CAGATGTAGGGTAGTAGGCCAGG + Intronic
1005608522 6:27500285-27500307 GAGAAGGAGGGAAGGAGGGATGG + Intergenic
1005827018 6:29638859-29638881 AAGAAGTAAGAGAGTAGGCCGGG + Intergenic
1005838014 6:29722682-29722704 GAGAAGAAGAGGAGGGGGGCGGG + Intergenic
1005849663 6:29812033-29812055 GAGATGTGGGGGAGGAGGGAAGG + Intergenic
1006303723 6:33207251-33207273 GGGGATTAGGGGAGGGGGCCAGG + Intergenic
1006377059 6:33677461-33677483 GAGAAGTAGGGAAGGGGCTCTGG + Intronic
1006441558 6:34056666-34056688 GAGAAGTAGCGGTCGAAGCCTGG + Exonic
1006442357 6:34060437-34060459 GGGAAGTGGGGTAGGAGGCGGGG - Intronic
1006640216 6:35485820-35485842 GAGGAATAGGGGAGCTGGCCAGG + Intronic
1007168138 6:39842826-39842848 GAGAAGAGGGGGAGGAAGCAGGG + Intronic
1007476811 6:42124572-42124594 GACAGGGAGGGGTGGAGGCCTGG + Intronic
1007498953 6:42280752-42280774 AAGGAGTGAGGGAGGAGGCCTGG + Intronic
1008047990 6:46871422-46871444 GAGTAGTAGGGGAGTGAGCCAGG + Intronic
1008695426 6:54030460-54030482 GAGAGTTAGGGAAGGAGTCCTGG + Intronic
1008969793 6:57354193-57354215 GAGAAGTAGGGAAGGAAGGAAGG - Intronic
1009158758 6:60256019-60256041 GAGAAGTAGGGAAGGAAGGAAGG - Intergenic
1009880373 6:69559813-69559835 GAGAATGAGGGAAGGAGGGCAGG - Intergenic
1010753422 6:79640132-79640154 GAGGAGTAGGGCAGGAGGGGAGG + Intronic
1010883236 6:81205368-81205390 CAGTATTAAGGGAGGAGGCCTGG + Intergenic
1010924925 6:81733327-81733349 GAGGAGTAGGGGACTAGGACTGG - Intronic
1011417435 6:87137306-87137328 GGGAAGGAGGGGAGGAGGGGAGG - Intergenic
1012818199 6:104051714-104051736 GACAGGTAGGGGAGGATGACAGG - Intergenic
1013201157 6:107897015-107897037 GAGAAGAAGGGAAGGAGGGAGGG + Intronic
1013215908 6:108027161-108027183 GAGAAGCAGTAGAGGAAGCCTGG + Intergenic
1013286818 6:108689256-108689278 GAGAAGGAGGGGTGGAGGATGGG + Intergenic
1013983099 6:116157061-116157083 GACATGGAGGGGAGGAGACCAGG + Intronic
1014154928 6:118099474-118099496 GAGGAGGAGGGGAGGAGGGGAGG - Intronic
1014271387 6:119340384-119340406 CAGAAATAGGACAGGAGGCCAGG - Intronic
1014806716 6:125838297-125838319 GGAAAGAAGAGGAGGAGGCCTGG + Intronic
1015809088 6:137143249-137143271 GAGAATTAGGGAGTGAGGCCTGG + Intergenic
1015862409 6:137694955-137694977 CAGGAGAAAGGGAGGAGGCCAGG - Intergenic
1016948055 6:149552165-149552187 GAGAAGTGAGAGGGGAGGCCGGG - Intergenic
1017449381 6:154540164-154540186 GAGAGGAAGGGGTGGAGGCGTGG - Intergenic
1017810733 6:157981804-157981826 AGGAGGAAGGGGAGGAGGCCGGG + Intergenic
1017978480 6:159377825-159377847 GAGAAGCAGGGGAGGCTCCCTGG + Intergenic
1018053266 6:160030091-160030113 GAGAAAGAGGGGAGAAGGCATGG - Intronic
1018142563 6:160853809-160853831 GAGAAGACGGTGAGGAAGCCAGG - Intergenic
1018167773 6:161115754-161115776 CAGAAGTGGGGGAGGGGGCATGG + Intronic
1018991284 6:168676074-168676096 GAAGAGGTGGGGAGGAGGCCAGG - Intergenic
1019196543 6:170286585-170286607 GGGAAGTGGGGGAGGAGGAGGGG - Intronic
1019223482 6:170493201-170493223 GAGAAGGAGGTGAGGAGGAGGGG + Intergenic
1019223511 6:170493274-170493296 GAGGAGGAGGGGAGGAGGGGAGG + Intergenic
1019223529 6:170493320-170493342 GAGGAGGAGGGGAGGAGGGGAGG + Intergenic
1019223540 6:170493347-170493369 GAGGAGGAGGGGAGGAGGGGAGG + Intergenic
1019223551 6:170493374-170493396 GAGGAGGAGGGGAGGAGGAGGGG + Intergenic
1019223567 6:170493423-170493445 GAGGAGGAGAGGAGGAGGGCAGG + Intergenic
1019228922 6:170540926-170540948 GAGGGGTAGGGGAGGAGGAGAGG + Intronic
1019377529 7:701215-701237 GAGAAGGAGGGAAGGAGGGAGGG + Intronic
1019511002 7:1417269-1417291 GAGGAGTTGGGGTGGTGGCCAGG - Intergenic
1019551804 7:1606845-1606867 GAGGAGGAGGGGAGGAGGGAAGG - Intergenic
1019590665 7:1829132-1829154 GACACGTAGGGCAGGAGTCCTGG + Intronic
1019924200 7:4181599-4181621 GAGGAGTGGGGCAGGAGGGCAGG - Intronic
1020253992 7:6491532-6491554 GAGGAGTGGGGAGGGAGGCCTGG + Intergenic
1020944729 7:14588559-14588581 GAGAGGGAGGGCCGGAGGCCAGG - Intronic
1021914645 7:25419285-25419307 GTGAAGTAAGTGAGGAGGCTTGG + Intergenic
1022109099 7:27217084-27217106 GAGAGCTAGGGGAGCAGGGCGGG + Intergenic
1022761929 7:33364712-33364734 GAGAGGAGGGGGAGGAGGACAGG - Intronic
1023025466 7:36045905-36045927 GAGAAACAGGGGAGGAGACAGGG + Intergenic
1023325464 7:39050785-39050807 GACAAGAAGGGGAGCAGCCCAGG + Intronic
1023368514 7:39489199-39489221 GAGGAGCAGGGAAGGAGGGCTGG - Intronic
1023398620 7:39774700-39774722 GCGAAGTCGGCAAGGAGGCCAGG + Intergenic
1023400134 7:39786741-39786763 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1023400191 7:39787045-39787067 GAGAAGTAGGGGAGGAGGCCAGG + Intergenic
1023475824 7:40576785-40576807 TTGTAGTAGGGGAGAAGGCCTGG + Intronic
1023830077 7:44034158-44034180 GACAGGTGGGAGAGGAGGCCTGG - Intergenic
1023863840 7:44229564-44229586 GAGAAGGACAGGGGGAGGCCAGG + Intronic
1023960458 7:44922063-44922085 GTGAGGAAGGGGAGGAGGGCTGG - Intergenic
1023970814 7:44989511-44989533 GAGAAGTGGGGGATGCGGCCAGG + Intergenic
1023991716 7:45132617-45132639 GAGAGGGAGGGAAGGAGGCAGGG + Intergenic
1024073119 7:45802796-45802818 GAGAAGTAGGGGAGGAGGCCAGG + Intergenic
1024258913 7:47559636-47559658 GAGATGTAGAGCAGGAGGGCTGG - Intronic
1024356186 7:48415933-48415955 GAGAGGTAGGGAAGGAAGGCAGG - Intronic
1024564883 7:50672952-50672974 GAGAAGTCGGAGGGGAAGCCGGG + Intronic
1024650212 7:51397392-51397414 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
1024650270 7:51397696-51397718 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1024651817 7:51410005-51410027 GCGAAGTCGGTGAGGAGGCCAGG - Intergenic
1025054359 7:55753041-55753063 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
1025054414 7:55753346-55753368 GAGAATTCGGGGAGGGGGCCAGG - Intergenic
1025117205 7:56268463-56268485 GAGGAGGAGGGGAGGAGGGGAGG - Intergenic
1025132409 7:56383194-56383216 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
1025132466 7:56383498-56383520 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1025134027 7:56395786-56395808 GCGAAGTCGGTGAGGAGGCCAGG - Intergenic
1025147359 7:56516321-56516343 GAGAAGTAGGTGGGGAGGGCTGG + Intergenic
1025183469 7:56837648-56837670 GAGAAGTAGGGGAGGAGGCCAGG - Intergenic
1025185614 7:56856006-56856028 GAGAAGTAGGGGAGGAGCCAGGG - Intergenic
1025686315 7:63720944-63720966 GAGAAGTAGGGGAGGAGCCAGGG + Intergenic
1025688456 7:63739319-63739341 GAGAAGTAGGGGAGGAGGCCAGG + Intergenic
1025909998 7:65820584-65820606 GTGAAGCAGGCGAGGAGGCCAGG + Intergenic
1025911524 7:65832530-65832552 GAGAATTAGGGCAGGAGGCCAGG + Intergenic
1025911568 7:65832814-65832836 GAGAAGTAGGAGAGGAGGCCAGG + Intergenic
1025929610 7:65983086-65983108 GAGAGGTAGAGGAGGAGATCTGG + Intergenic
1025945080 7:66099166-66099188 GAGAAGGAGCGGAGGAGGAGGGG + Intronic
1025945119 7:66099300-66099322 GAGAAGGAGCGGAGGAGGAGGGG + Intronic
1025945128 7:66099325-66099347 TAGAAGGAGGGGAGGAGGAGGGG + Intronic
1025945133 7:66099336-66099358 GAGGAGGAGGGGAGGAGGAGGGG + Intronic
1025978080 7:66385462-66385484 GAGAAGTAGGGGAGGAGGCCAGG - Intronic
1026044240 7:66894829-66894851 GAGAAGTAAGGGAGCAGGCCAGG + Intergenic
1026319016 7:69252789-69252811 CAGAAGTAGGCGGGGAGGGCCGG - Intergenic
1026384264 7:69830226-69830248 GAGCAGTGTGGGAGGAGGCAAGG + Intronic
1026453575 7:70551305-70551327 GAGTAGTAGGGGAGGGGGAGGGG + Intronic
1026513988 7:71051307-71051329 GAAAAGTAAGGGATCAGGCCAGG + Intergenic
1026696475 7:72598215-72598237 GAGATGTAGGGTGGGAGGCTAGG - Intronic
1027203661 7:76080126-76080148 GAGAAGTTGGGGAGGAGGCCAGG - Intergenic
1027390294 7:77696962-77696984 GAGAAGGAGAGGAGGAGGCACGG + Exonic
1027945764 7:84743742-84743764 GAAAAGAAGAGAAGGAGGCCAGG - Intergenic
1029030455 7:97461255-97461277 AAAAAGTAAGGGAGGTGGCCAGG + Intergenic
1029105360 7:98170819-98170841 GGGAAGTCTTGGAGGAGGCCTGG + Intronic
1029193237 7:98786514-98786536 TGGAAGTTGGGGAGGAGGCAAGG - Intergenic
1029448015 7:100625586-100625608 AAGAAGGAGAGGAGAAGGCCAGG + Intronic
1029495772 7:100895018-100895040 GGGAACTTGGGGAGGGGGCCTGG + Intronic
1029598853 7:101552079-101552101 GACAAGCACGGGAGGAGGCATGG - Intronic
1029740393 7:102488445-102488467 GACAGGTGGGAGAGGAGGCCTGG - Exonic
1029758389 7:102587617-102587639 GACAGGTGGGAGAGGAGGCCTGG - Exonic
1029776327 7:102686696-102686718 GACAGGTGGGAGAGGAGGCCTGG - Intergenic
1030116088 7:106063296-106063318 GAGGAGAAGATGAGGAGGCCTGG + Intergenic
1031084217 7:117286463-117286485 GAGAAGGAGGTGAGGAGGAGAGG - Intronic
1031641902 7:124174822-124174844 GAGATGTATGGGATGAGGTCTGG + Intergenic
1031993023 7:128210159-128210181 GAGAAGGAGGGGAGGTGGGAGGG + Intergenic
1031997897 7:128244916-128244938 GAGAAGGAAGGGAGGAGGAAAGG + Intronic
1032015729 7:128379321-128379343 GGGCAGGAGGGGAGAAGGCCAGG - Intergenic
1032050449 7:128646186-128646208 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1032050506 7:128646490-128646512 GAGAAGTAGGGGAGGAGGCCAGG + Intergenic
1032141470 7:129335084-129335106 GAGAAGTAAAGCAGCAGGCCGGG + Intronic
1032169766 7:129574944-129574966 GGGAAGTGGTGGAGGGGGCCTGG - Intergenic
1033378798 7:140791807-140791829 GAGAAGTAGAGGATAATGCCAGG - Intronic
1033423188 7:141220521-141220543 GGGAGGGAAGGGAGGAGGCCTGG + Intronic
1033582404 7:142749754-142749776 GAGAAGCTGGGAAGGGGGCCAGG + Intronic
1034007604 7:147491208-147491230 GAGATGTAGGGGAGGAAATCAGG - Intronic
1034269836 7:149798141-149798163 AAGAGTTTGGGGAGGAGGCCTGG - Intergenic
1034271383 7:149804893-149804915 GAGAAGTGGGGCTGGAGGCCAGG + Intergenic
1034474925 7:151276519-151276541 GGGAAGGAGGGGAAGATGCCAGG + Intronic
1034497909 7:151433110-151433132 GTGCAGAAGGGGAGGAGGACAGG - Intronic
1034647953 7:152665101-152665123 GAGAAGGATGAGAGGAGACCAGG + Intronic
1034697456 7:153066473-153066495 GAGAGGTAGGGAAGGAGGGCAGG + Intergenic
1035043988 7:155952232-155952254 GAGAAGCAGAGGAGGTGGGCAGG - Intergenic
1035524160 8:299038-299060 GAGAAGAAGTGGTGAAGGCCTGG - Intergenic
1035612171 8:973870-973892 GCGGAGGAGGGGAAGAGGCCTGG - Intergenic
1035764152 8:2092189-2092211 CAGGAGTAGGAGAGGAGCCCCGG - Intronic
1035971891 8:4258353-4258375 GAGAAGGAGGGAAGGAGGGAGGG + Intronic
1036056762 8:5263459-5263481 GAGGAGCAGGGGATGAGCCCTGG + Intergenic
1036686503 8:10914957-10914979 GTGCAGGAGGGGAGGCGGCCAGG - Intronic
1036975386 8:13405282-13405304 GAGAAGGAGGGAGGGAGGCAAGG - Intronic
1037583691 8:20261941-20261963 GAGAAGGAGGGAAGGATGTCAGG - Intronic
1037620508 8:20559493-20559515 GAGAAGTAGGGAATGAAGTCAGG - Intergenic
1037774406 8:21823401-21823423 GAGAAGGAGGGAAGGAGGGAAGG - Intergenic
1037805208 8:22055011-22055033 GAGAAGGAGGGGAGGGTGCTCGG - Intronic
1038211881 8:25526047-25526069 AAGAACTAGAGAAGGAGGCCAGG + Intergenic
1038302872 8:26370890-26370912 GAGATGAAGGGGAGCAGTCCAGG - Intronic
1038632763 8:29262457-29262479 GGGAAGAAGGGCAGGGGGCCAGG - Intronic
1038743344 8:30234754-30234776 GAGGAAGAGGGGAAGAGGCCAGG - Intergenic
1039395962 8:37225363-37225385 GACAGGCAGGGGAGAAGGCCTGG - Intergenic
1040875619 8:52148688-52148710 GGGAAGGAGGGGAGGAGGGGAGG + Intronic
1040886234 8:52266819-52266841 AAGAAATAGTGGAAGAGGCCAGG - Intronic
1041320555 8:56607902-56607924 GAGTGGGAGGAGAGGAGGCCTGG + Intergenic
1041466552 8:58163058-58163080 GAGAAGTAGGGGAGCGGCTCTGG + Intronic
1042369350 8:67973117-67973139 GAGAAGAAGCAGGGGAGGCCTGG - Intronic
1042902869 8:73746467-73746489 GGGAGGAAGGCGAGGAGGCCGGG - Intronic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1043563878 8:81526323-81526345 GAGAAGTGGGGAAGGTGACCTGG + Intronic
1044394646 8:91696497-91696519 GGGAAGCTGGGGAGGAGGCCGGG - Intergenic
1044703710 8:94987922-94987944 GAGAGGTAGGGGAGAACGCTAGG - Intronic
1045379856 8:101612283-101612305 AAGAAGTAAGAGAGAAGGCCAGG - Intronic
1045647814 8:104316525-104316547 GAGGAGTAGGGGAGGGAGCTGGG + Intergenic
1046179000 8:110618315-110618337 GAGGAGTGGGGGAGGAGGAGGGG - Intergenic
1046820117 8:118624990-118625012 GAGAGGTATGGGATGAGGTCTGG - Intergenic
1047225450 8:122952478-122952500 CAGAAGAGGTGGAGGAGGCCCGG + Exonic
1047312854 8:123706941-123706963 GAGAAGTAGGAGTGGAGGTGAGG - Intronic
1047731407 8:127731883-127731905 AAGAAGAAGGAGAGGAGGCTGGG + Intergenic
1048366438 8:133742703-133742725 GGGAAGGAGGGGAGGAGGGAAGG + Intergenic
1049155158 8:141061817-141061839 GAGAAGTGGAGGTGGAGGCCAGG + Intergenic
1049353533 8:142176817-142176839 TAGAAGTCAGGGAGGAGCCCAGG - Intergenic
1049413850 8:142486189-142486211 GGGATGTAGGGGTGGGGGCCTGG - Intronic
1049509164 8:143018987-143019009 GAGGACTAGGGGAGGGGGCACGG + Exonic
1049547957 8:143243355-143243377 GAGAAGGGGGGGAGGAGGAGGGG + Intergenic
1049620185 8:143594631-143594653 GAGAAGTCAGGGAGGTGGGCAGG + Intronic
1049674034 8:143881862-143881884 GAGAAGGAGGGGAGGAGAAGGGG + Intergenic
1049718904 8:144106684-144106706 GGGAGGTGGGGGAGGAGGCGGGG - Intronic
1049852533 8:144840742-144840764 GAGAAGCAGGGGAGGTGGCCAGG + Intronic
1050388304 9:5112313-5112335 GAGAGGTCGGGGAGGGCGCCTGG - Intronic
1050571126 9:6940049-6940071 GAGAAGGAGGGAAGGAGGGAAGG - Intronic
1051769024 9:20556387-20556409 AAAAAGTGGGGGAGAAGGCCAGG + Intronic
1052012954 9:23432505-23432527 GATGAGTAGGAGAGGATGCCAGG - Intergenic
1052435680 9:28425478-28425500 AAGAAGTAGTGGAGGCAGCCTGG + Intronic
1052512725 9:29441880-29441902 GAGAAACTGGGGAGGAAGCCTGG + Intergenic
1053142745 9:35691172-35691194 GAGAACAAGCGGAGGAAGCCGGG + Intergenic
1053656052 9:40219190-40219212 AGAAGGTAGGGGAGGAGGCCAGG + Intergenic
1053906398 9:42848392-42848414 AGAAGGTAGGGGAGGAGGCCAGG + Intergenic
1054323324 9:63695766-63695788 GAGGAGAAGGGGAGGAGAACGGG + Intergenic
1054352417 9:64029219-64029241 GAGAAGTAGGGAAGAAGGCCAGG + Intergenic
1054368158 9:64365414-64365436 AGAAGGTAGGGGAGGAGGCCAGG + Intergenic
1054528562 9:66157105-66157127 AGAAGGTAGGGGAGGAGGCCAGG - Intergenic
1054675778 9:67855157-67855179 AGAAGGTAGGGGAGGAGGCCAGG + Intergenic
1054850649 9:69843455-69843477 GAGAAGTAGGAGGGGAGGGGAGG - Intronic
1055074565 9:72200289-72200311 GAAAAGAAGGAGAGGAGGCTGGG - Intronic
1055183659 9:73422768-73422790 TAGAGGGAGGGGAGGAGGCAGGG + Intergenic
1055560044 9:77513636-77513658 GAGAGGAAGGGGCAGAGGCCAGG - Intronic
1055738676 9:79361785-79361807 AAGAAGTAGGGAAGGAGGGAGGG + Intergenic
1055956190 9:81775840-81775862 AAGAAGTAGGGAAGGAGGAGGGG - Intergenic
1056123116 9:83509017-83509039 TAAAAGTTGGGGAGGAGGCAAGG - Intronic
1056147383 9:83746084-83746106 AAGAATTATGGGGGGAGGCCAGG - Intronic
1056286285 9:85090908-85090930 TAGAAGTAGAGGAGCAGGCATGG + Intergenic
1056412045 9:86338955-86338977 GAGAGGTGGGGGAGGAGGATGGG + Intronic
1056465779 9:86852986-86853008 GGGAGGTAGGGAAGGAGGCCAGG - Intergenic
1056484090 9:87036730-87036752 GAGAACTAGGGGAGCTGGCATGG - Intergenic
1056737935 9:89225737-89225759 TAAAAGCAAGGGAGGAGGCCAGG - Intergenic
1057298731 9:93864334-93864356 GAGGAGTGGGGGAAGGGGCCCGG - Intergenic
1057372985 9:94490765-94490787 GAGAAGTAGGGTAGGATGCCAGG + Intergenic
1058460148 9:105174993-105175015 AAGAAGTAAAGGAAGAGGCCAGG - Intergenic
1058638455 9:107059455-107059477 GAACAGTAGGGGAGGAAGCGAGG + Intergenic
1059114259 9:111586684-111586706 GAGTAGTAGGGGTGGAAGGCAGG - Intronic
1060050859 9:120377139-120377161 GAGAAGGAGGGGAGAAGGGCTGG + Intergenic
1060066694 9:120508342-120508364 GTGAAGTGAGGTAGGAGGCCTGG - Intronic
1060280452 9:122212645-122212667 GAGGAGTGAGGGAGGAGCCCCGG - Intronic
1060491102 9:124084898-124084920 GAGAAGGAGGGGCTGAGGACAGG + Intergenic
1060934024 9:127505656-127505678 AAGCAGCAGGGGAGGGGGCCTGG + Exonic
1061098271 9:128472788-128472810 GAAAAGTAGGGGAGGGGGCAGGG - Intronic
1061264440 9:129497147-129497169 GAGAAGGAGGGGAGGCAGCAGGG + Intergenic
1061668599 9:132175105-132175127 GAGACGCAGGGAAGGGGGCCAGG + Intronic
1062163895 9:135096083-135096105 GAGAAGGAGGAGAGGAGGGAGGG - Intronic
1062359671 9:136181817-136181839 GAGAGGGAGGGGAGGAGGGAAGG + Intergenic
1062368062 9:136221353-136221375 GAGAAGTAGGGGTGGGCACCAGG - Intronic
1062372029 9:136245078-136245100 AACAGGTAGGGTAGGAGGCCTGG + Intronic
1062752558 9:138266386-138266408 GCGAAGTCAGCGAGGAGGCCAGG + Intergenic
1203553025 Un_KI270743v1:180121-180143 GAGAAGTAGGGAAGGAGGCCAGG + Intergenic
1203575072 Un_KI270745v1:1161-1183 GCGAAGTCAGCGAGGAGGCCAGG + Intergenic
1185575585 X:1169330-1169352 GAGAAGTGGGGGAGGGGGAAGGG + Intergenic
1186467830 X:9797733-9797755 GAGCATTGGGGCAGGAGGCCGGG + Intronic
1186490714 X:9970215-9970237 GAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1186490773 X:9970448-9970470 GAGAAGGAGGGAAGGAGGGAAGG - Intergenic
1186490805 X:9970557-9970579 GAGAAGGAGGAGAGGAGGGAGGG - Intergenic
1186830279 X:13383295-13383317 GAGAAGGAGGAGAGGAGGCCTGG + Intergenic
1186899944 X:14043380-14043402 GAAAAGTCAGGGAGGAGGACAGG + Intergenic
1186984389 X:14996419-14996441 TAGAAGTAGGGTAGGGGGCAGGG - Intergenic
1187103502 X:16218620-16218642 GAGAGGTAGTGGAGGGGGGCAGG + Intergenic
1187671237 X:21667824-21667846 GAGGAGAAGGGGAGGAGACAGGG - Intergenic
1188217843 X:27501237-27501259 GAGAAGAGGGGGAGGAGGAGGGG - Intergenic
1189048405 X:37617977-37617999 CAGAAGTAGGGTGGGATGCCTGG + Intronic
1189248435 X:39581261-39581283 CAGAAGCAGGTGATGAGGCCAGG + Intergenic
1189288316 X:39867528-39867550 GAGGGGGAGGGGAGGAGCCCTGG - Intergenic
1190009185 X:46768691-46768713 GAGACGGAGGGGAGGTGGCAGGG - Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190240480 X:48654345-48654367 GAGAAACAGGGAAGGAGGACGGG + Intergenic
1191979500 X:66910482-66910504 GAGCAGTAGGAGATGTGGCCGGG + Intergenic
1192341145 X:70264349-70264371 GAGAAGGAGGGAAGGAGGGAGGG + Intergenic
1192345437 X:70300076-70300098 GAGAAGAAGGGAAGGAGAACAGG - Intronic
1192451539 X:71248086-71248108 GAGGAGAAGGGAGGGAGGCCGGG - Intronic
1192547861 X:72028531-72028553 GAGATCTGGGGAAGGAGGCCAGG - Intergenic
1192577671 X:72255768-72255790 GAGAGGCAGGGAAGGAGGCCGGG + Intronic
1192623850 X:72707512-72707534 GAGAAAAAGGGGCAGAGGCCAGG + Intronic
1192698991 X:73447793-73447815 GAGAAGTAGCGGAGAAGGGAAGG - Intronic
1193136005 X:77971171-77971193 GAGTGGTAGAAGAGGAGGCCAGG + Intronic
1193393210 X:80954154-80954176 GAGAAGGGAGGGAGGATGCCAGG - Intergenic
1193800936 X:85935189-85935211 GGGAGGGAGGAGAGGAGGCCAGG + Intronic
1194618318 X:96135625-96135647 CAGAAGTGGGGGAGGAGTCAGGG - Intergenic
1194982554 X:100455028-100455050 GAGAAGGAGGGAAGGAGGGAAGG + Intergenic
1197747293 X:129940180-129940202 GGGAAGTAGGGGCGGGGCCCAGG - Intergenic
1198074137 X:133178723-133178745 GAGCAGTAGAGGAGGGGCCCAGG - Intergenic
1198237028 X:134745131-134745153 GTCAACTGGGGGAGGAGGCCAGG - Intronic
1199213673 X:145243302-145243324 GAGAAGAGTGGGAGGAGGCGAGG + Intergenic
1199907961 X:152254234-152254256 GAGAAGTAGGGGAAGGGACATGG - Intronic
1200059484 X:153477914-153477936 GTCAAGGTGGGGAGGAGGCCTGG - Intronic
1201154307 Y:11115776-11115798 GAGAAGTAGGGAAGGAGGCCAGG + Intergenic
1201224723 Y:11807825-11807847 GAGAAGGAGAGGAGGAGGAAGGG - Intergenic
1201300213 Y:12498658-12498680 GAGGAGGAGGGGAGGAGGAGGGG - Intergenic
1201507389 Y:14717410-14717432 CAGAAGTAGTGGTGAAGGCCTGG + Intronic
1202273899 Y:23096271-23096293 GAGAAGGAGGGGAGAAGGGGAGG + Intergenic
1202292127 Y:23324406-23324428 GAGAAGGAGGGGAGAAGGGGAGG - Intergenic
1202379633 Y:24264118-24264140 GAAAAGTAGGGAAGTAGGCAAGG - Intergenic
1202426895 Y:24730016-24730038 GAGAAGGAGGGGAGAAGGGGAGG + Intergenic
1202443896 Y:24940078-24940100 GAGAAGGAGGGGAGAAGGGGAGG - Intergenic
1202491149 Y:25406003-25406025 GAAAAGTAGGGAAGTAGGCAAGG + Intergenic