ID: 1025132413

View in Genome Browser
Species Human (GRCh38)
Location 7:56383206-56383228
Sequence ATGGTCAGAGGGGAGAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132413_1025132419 1 Left 1025132413 7:56383206-56383228 CCCTACTTCTCCCCTCTGACCAT No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132413_1025132420 6 Left 1025132413 7:56383206-56383228 CCCTACTTCTCCCCTCTGACCAT No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132413_1025132425 28 Left 1025132413 7:56383206-56383228 CCCTACTTCTCCCCTCTGACCAT No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132413 Original CRISPR ATGGTCAGAGGGGAGAAGTA GGG (reversed) Intergenic