ID: 1025132415

View in Genome Browser
Species Human (GRCh38)
Location 7:56383216-56383238
Sequence GTGTTGAGAGATGGTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132415_1025132420 -4 Left 1025132415 7:56383216-56383238 CCCCTCTGACCATCTCTCAACAC No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132415_1025132425 18 Left 1025132415 7:56383216-56383238 CCCCTCTGACCATCTCTCAACAC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132415_1025132419 -9 Left 1025132415 7:56383216-56383238 CCCCTCTGACCATCTCTCAACAC No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132415 Original CRISPR GTGTTGAGAGATGGTCAGAG GGG (reversed) Intergenic
No off target data available for this crispr