ID: 1025132419

View in Genome Browser
Species Human (GRCh38)
Location 7:56383230-56383252
Sequence TCTCAACACCACCACGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132413_1025132419 1 Left 1025132413 7:56383206-56383228 CCCTACTTCTCCCCTCTGACCAT No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132406_1025132419 24 Left 1025132406 7:56383183-56383205 CCCAGCAACTCCCTGGCCTCCTC 0: 31
1: 18
2: 13
3: 67
4: 529
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132410_1025132419 8 Left 1025132410 7:56383199-56383221 CCTCCTCCCCTACTTCTCCCCTC No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132405_1025132419 27 Left 1025132405 7:56383180-56383202 CCACCCAGCAACTCCCTGGCCTC 0: 13
1: 10
2: 11
3: 65
4: 829
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132414_1025132419 0 Left 1025132414 7:56383207-56383229 CCTACTTCTCCCCTCTGACCATC No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132415_1025132419 -9 Left 1025132415 7:56383216-56383238 CCCCTCTGACCATCTCTCAACAC No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132416_1025132419 -10 Left 1025132416 7:56383217-56383239 CCCTCTGACCATCTCTCAACACC No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132412_1025132419 2 Left 1025132412 7:56383205-56383227 CCCCTACTTCTCCCCTCTGACCA No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132403_1025132419 29 Left 1025132403 7:56383178-56383200 CCCCACCCAGCAACTCCCTGGCC 0: 16
1: 9
2: 27
3: 59
4: 666
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132411_1025132419 5 Left 1025132411 7:56383202-56383224 CCTCCCCTACTTCTCCCCTCTGA No data
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132407_1025132419 23 Left 1025132407 7:56383184-56383206 CCAGCAACTCCCTGGCCTCCTCC 0: 13
1: 36
2: 22
3: 116
4: 787
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132409_1025132419 13 Left 1025132409 7:56383194-56383216 CCTGGCCTCCTCCCCTACTTCTC 0: 13
1: 15
2: 16
3: 96
4: 958
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132404_1025132419 28 Left 1025132404 7:56383179-56383201 CCCACCCAGCAACTCCCTGGCCT 0: 13
1: 31
2: 9
3: 48
4: 425
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data
1025132408_1025132419 14 Left 1025132408 7:56383193-56383215 CCCTGGCCTCCTCCCCTACTTCT 0: 13
1: 15
2: 15
3: 78
4: 777
Right 1025132419 7:56383230-56383252 TCTCAACACCACCACGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132419 Original CRISPR TCTCAACACCACCACGACCC TGG Intergenic
No off target data available for this crispr