ID: 1025132420

View in Genome Browser
Species Human (GRCh38)
Location 7:56383235-56383257
Sequence ACACCACCACGACCCTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132412_1025132420 7 Left 1025132412 7:56383205-56383227 CCCCTACTTCTCCCCTCTGACCA No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132411_1025132420 10 Left 1025132411 7:56383202-56383224 CCTCCCCTACTTCTCCCCTCTGA No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132415_1025132420 -4 Left 1025132415 7:56383216-56383238 CCCCTCTGACCATCTCTCAACAC No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132407_1025132420 28 Left 1025132407 7:56383184-56383206 CCAGCAACTCCCTGGCCTCCTCC 0: 13
1: 36
2: 22
3: 116
4: 787
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132413_1025132420 6 Left 1025132413 7:56383206-56383228 CCCTACTTCTCCCCTCTGACCAT No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132409_1025132420 18 Left 1025132409 7:56383194-56383216 CCTGGCCTCCTCCCCTACTTCTC 0: 13
1: 15
2: 16
3: 96
4: 958
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132406_1025132420 29 Left 1025132406 7:56383183-56383205 CCCAGCAACTCCCTGGCCTCCTC 0: 31
1: 18
2: 13
3: 67
4: 529
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132410_1025132420 13 Left 1025132410 7:56383199-56383221 CCTCCTCCCCTACTTCTCCCCTC No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132416_1025132420 -5 Left 1025132416 7:56383217-56383239 CCCTCTGACCATCTCTCAACACC No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132414_1025132420 5 Left 1025132414 7:56383207-56383229 CCTACTTCTCCCCTCTGACCATC No data
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132408_1025132420 19 Left 1025132408 7:56383193-56383215 CCCTGGCCTCCTCCCCTACTTCT 0: 13
1: 15
2: 15
3: 78
4: 777
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data
1025132417_1025132420 -6 Left 1025132417 7:56383218-56383240 CCTCTGACCATCTCTCAACACCA 0: 13
1: 4
2: 1
3: 26
4: 233
Right 1025132420 7:56383235-56383257 ACACCACCACGACCCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132420 Original CRISPR ACACCACCACGACCCTGGTC AGG Intergenic
No off target data available for this crispr