ID: 1025132425

View in Genome Browser
Species Human (GRCh38)
Location 7:56383257-56383279
Sequence GACCACCATCATCTCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025132421_1025132425 -4 Left 1025132421 7:56383238-56383260 CCACCACGACCCTGGTCAGGACC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132414_1025132425 27 Left 1025132414 7:56383207-56383229 CCTACTTCTCCCCTCTGACCATC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132412_1025132425 29 Left 1025132412 7:56383205-56383227 CCCCTACTTCTCCCCTCTGACCA No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132422_1025132425 -7 Left 1025132422 7:56383241-56383263 CCACGACCCTGGTCAGGACCACC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132418_1025132425 9 Left 1025132418 7:56383225-56383247 CCATCTCTCAACACCACCACGAC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132413_1025132425 28 Left 1025132413 7:56383206-56383228 CCCTACTTCTCCCCTCTGACCAT No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132417_1025132425 16 Left 1025132417 7:56383218-56383240 CCTCTGACCATCTCTCAACACCA 0: 13
1: 4
2: 1
3: 26
4: 233
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132416_1025132425 17 Left 1025132416 7:56383217-56383239 CCCTCTGACCATCTCTCAACACC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data
1025132415_1025132425 18 Left 1025132415 7:56383216-56383238 CCCCTCTGACCATCTCTCAACAC No data
Right 1025132425 7:56383257-56383279 GACCACCATCATCTCCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025132425 Original CRISPR GACCACCATCATCTCCCGCC TGG Intergenic
No off target data available for this crispr