ID: 1025139892

View in Genome Browser
Species Human (GRCh38)
Location 7:56454062-56454084
Sequence AGATGTACTCAGCAGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025139892_1025139894 17 Left 1025139892 7:56454062-56454084 CCAGACAACTGCTGAGTACATCT No data
Right 1025139894 7:56454102-56454124 TTTTTTTTTTTTTTTTGAGGTGG 0: 2598
1: 87701
2: 64565
3: 96317
4: 154151
1025139892_1025139893 14 Left 1025139892 7:56454062-56454084 CCAGACAACTGCTGAGTACATCT No data
Right 1025139893 7:56454099-56454121 TTTTTTTTTTTTTTTTTTTGAGG 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025139892 Original CRISPR AGATGTACTCAGCAGTTGTC TGG (reversed) Intergenic
No off target data available for this crispr