ID: 1025143076

View in Genome Browser
Species Human (GRCh38)
Location 7:56482032-56482054
Sequence TGTTGGGTATAAAAACTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025143076_1025143086 22 Left 1025143076 7:56482032-56482054 CCCCCCAGTTTTTATACCCAACA No data
Right 1025143086 7:56482077-56482099 ATATAAATAAAACCATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025143076 Original CRISPR TGTTGGGTATAAAAACTGGG GGG (reversed) Intergenic
No off target data available for this crispr