ID: 1025147242

View in Genome Browser
Species Human (GRCh38)
Location 7:56515416-56515438
Sequence CCAGAAAACAAGAGCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025147238_1025147242 20 Left 1025147238 7:56515373-56515395 CCAAGTGCACTTGAATTTGCGTT No data
Right 1025147242 7:56515416-56515438 CCAGAAAACAAGAGCAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025147242 Original CRISPR CCAGAAAACAAGAGCAAAGC TGG Intergenic
No off target data available for this crispr