ID: 1025150610

View in Genome Browser
Species Human (GRCh38)
Location 7:56543585-56543607
Sequence CTGTGCAGAACTGGACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025150602_1025150610 -6 Left 1025150602 7:56543568-56543590 CCCCGATCCGTGGCCTCCTGTGC No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data
1025150600_1025150610 3 Left 1025150600 7:56543559-56543581 CCTGGGCCTCCCCGATCCGTGGC No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data
1025150604_1025150610 -8 Left 1025150604 7:56543570-56543592 CCGATCCGTGGCCTCCTGTGCAG No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data
1025150603_1025150610 -7 Left 1025150603 7:56543569-56543591 CCCGATCCGTGGCCTCCTGTGCA No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data
1025150598_1025150610 7 Left 1025150598 7:56543555-56543577 CCTGCCTGGGCCTCCCCGATCCG No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data
1025150597_1025150610 8 Left 1025150597 7:56543554-56543576 CCCTGCCTGGGCCTCCCCGATCC No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data
1025150601_1025150610 -3 Left 1025150601 7:56543565-56543587 CCTCCCCGATCCGTGGCCTCCTG No data
Right 1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025150610 Original CRISPR CTGTGCAGAACTGGACCCCA GGG Intergenic
No off target data available for this crispr