ID: 1025152469

View in Genome Browser
Species Human (GRCh38)
Location 7:56569383-56569405
Sequence CAGTTGTCCGCGTGCGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025152469_1025152473 13 Left 1025152469 7:56569383-56569405 CCACCTGCGCACGCGGACAACTG No data
Right 1025152473 7:56569419-56569441 CAACCGCTCCCTGGCAACTAAGG No data
1025152469_1025152471 -10 Left 1025152469 7:56569383-56569405 CCACCTGCGCACGCGGACAACTG No data
Right 1025152471 7:56569396-56569418 CGGACAACTGCTCAGCTCTATGG No data
1025152469_1025152472 4 Left 1025152469 7:56569383-56569405 CCACCTGCGCACGCGGACAACTG No data
Right 1025152472 7:56569410-56569432 GCTCTATGGCAACCGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025152469 Original CRISPR CAGTTGTCCGCGTGCGCAGG TGG (reversed) Intergenic
No off target data available for this crispr