ID: 1025156108

View in Genome Browser
Species Human (GRCh38)
Location 7:56606946-56606968
Sequence CAGTTTCACTTCTAGGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025156104_1025156108 30 Left 1025156104 7:56606893-56606915 CCTAGAAGTTTTCTCCTTATATA No data
Right 1025156108 7:56606946-56606968 CAGTTTCACTTCTAGGAACACGG No data
1025156105_1025156108 16 Left 1025156105 7:56606907-56606929 CCTTATATAAATTAAGTAAGAAT No data
Right 1025156108 7:56606946-56606968 CAGTTTCACTTCTAGGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025156108 Original CRISPR CAGTTTCACTTCTAGGAACA CGG Intergenic
No off target data available for this crispr