ID: 1025157642

View in Genome Browser
Species Human (GRCh38)
Location 7:56623740-56623762
Sequence GTTGAGATTGACTCCTTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 18, 1: 25, 2: 60, 3: 56, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025157642_1025157647 13 Left 1025157642 7:56623740-56623762 CCCTTTAAGGAGTCAATCTCAAC 0: 18
1: 25
2: 60
3: 56
4: 175
Right 1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG No data
1025157642_1025157645 4 Left 1025157642 7:56623740-56623762 CCCTTTAAGGAGTCAATCTCAAC 0: 18
1: 25
2: 60
3: 56
4: 175
Right 1025157645 7:56623767-56623789 AGAGCCAGTAAGCACCCCTTGGG No data
1025157642_1025157644 3 Left 1025157642 7:56623740-56623762 CCCTTTAAGGAGTCAATCTCAAC 0: 18
1: 25
2: 60
3: 56
4: 175
Right 1025157644 7:56623766-56623788 CAGAGCCAGTAAGCACCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025157642 Original CRISPR GTTGAGATTGACTCCTTAAA GGG (reversed) Intergenic
901001742 1:6152197-6152219 GTTTAGATTGAATCCTTCCAAGG - Intronic
904006881 1:27367540-27367562 GCTGGGGTTGACTCCTTCAAGGG - Intergenic
906410629 1:45575985-45576007 CTCGAGCTTGACTGCTTAAAGGG + Intergenic
909863403 1:80636360-80636382 GGAGAGATTGACTCCTTAAAGGG - Intergenic
910386986 1:86694472-86694494 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
910626705 1:89314945-89314967 GTTGAGCTTGACTCTTTAAAGGG + Intergenic
911299472 1:96154514-96154536 GTTGAGCTTGACTCCTTTAAGGG + Intergenic
912094191 1:106119249-106119271 GTTAAGCTTGATACCTTAAAAGG - Intergenic
912362974 1:109110280-109110302 GTAAATATTGACTCCTGAAAAGG - Intronic
913025066 1:114829974-114829996 GTTGAGCTTGACTCTTTAAAGGG + Intergenic
913030653 1:114899046-114899068 GTCAAGTTTGACTGCTTAAAGGG + Intronic
913103332 1:115590596-115590618 GTTGAACTTGACTCCTTAAAGGG - Intergenic
913551895 1:119924453-119924475 GTTGGGATTCACTCTTGAAAGGG - Intronic
914197916 1:145459753-145459775 GTTGTGTTTTACTCCCTAAATGG + Intergenic
914477018 1:148032885-148032907 GTTGTGTTTTACTCCCTAAATGG + Intergenic
915672527 1:157502454-157502476 GTCAAGCTTGACTCCTTAAAGGG - Intergenic
917077037 1:171216113-171216135 GTTGAGATTAACTCCTTAAGAGG + Intergenic
917083925 1:171286304-171286326 GTTCTCATTGACTCTTTAAAAGG - Intergenic
917556855 1:176099698-176099720 GTCGAGCTTGACTCCTTAAAGGG - Intronic
918175197 1:182037369-182037391 GTCGAGCTTGACTCTTTAAAGGG + Intergenic
919280580 1:195483852-195483874 GTCGAATTTGACTCCTTAAAGGG + Intergenic
920640383 1:207746455-207746477 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
923241585 1:232090274-232090296 CCAGAGATTGAATCCTTAAAGGG + Intergenic
923285521 1:232491200-232491222 GTTGATTTTGTTTCCTTAAATGG - Intronic
923412923 1:233727480-233727502 GTTGAGCTTGACTCCTTAAAGGG + Intergenic
923914126 1:238483342-238483364 GTCAAGATTGACTCCGTAAAGGG + Intergenic
1064175338 10:13070443-13070465 GTCAAGCTTGACTCCTTAAAGGG - Intronic
1065151605 10:22827985-22828007 GTTGAGCTTGACTCCTTAAAGGG + Intergenic
1066460105 10:35605686-35605708 GGTGGAATTGAGTCCTTAAAGGG + Intronic
1068278607 10:54837601-54837623 GTTTAGATTGACTCGTTCAAAGG - Intronic
1071012553 10:80954984-80955006 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1071145871 10:82570564-82570586 ATTGAGATTGACTTTTTAAGAGG + Intronic
1071926322 10:90414287-90414309 GTCGAGATTGACTCCTTAAAGGG - Intergenic
1073506248 10:103994708-103994730 GTTTAAAATGACTCCTTAGAGGG + Intronic
1073574456 10:104610887-104610909 GTCGAGCTTGACTCCTTAAAGGG - Intergenic
1073589393 10:104742161-104742183 GTTTAGATTGACACCCTAAGAGG + Intronic
1075181762 10:120217491-120217513 GTTTTGATTGCCTCTTTAAAAGG + Intergenic
1076633824 10:131869883-131869905 GTTCAATTTTACTCCTTAAATGG - Intergenic
1080058280 11:27930051-27930073 GTCAAGTTTGATTCCTTAAAGGG + Intergenic
1081827413 11:46070235-46070257 ATTGAGAATGATTCCATAAACGG + Intronic
1082228528 11:49736909-49736931 GCTGAGATTCACTCTTTAAAGGG + Intergenic
1082656155 11:55859630-55859652 GTCGAGATTGACTCTTTAAAGGG - Intergenic
1082737303 11:56871147-56871169 GTCAAGTTTGATTCCTTAAAGGG - Intergenic
1083611485 11:64006506-64006528 GGTGAGATCAGCTCCTTAAATGG + Intronic
1084976107 11:72799416-72799438 ATTTAGGTTGACACCTTAAAGGG - Intergenic
1085566929 11:77522387-77522409 GTTGAGCTTGACTCCTTAAAGGG + Intronic
1086302524 11:85443207-85443229 GAGGAGATTGACATCTTAAAGGG - Intronic
1086621546 11:88892239-88892261 GCTGAGATTGACTCTTTAAAGGG - Intronic
1087002846 11:93438704-93438726 GATGAGATTGTTTCTTTAAAGGG - Intergenic
1087432068 11:98067236-98067258 GTGGAGATTGACTCCTTAAAGGG + Intergenic
1087486072 11:98761348-98761370 GTTGAGATTGACTCCCCAAAGGG - Intergenic
1090291383 11:125548184-125548206 GTACAGGTTGACTCCTTAAAGGG + Intergenic
1090989172 11:131800863-131800885 GTTGAAATTGTCCCCTTTAATGG + Intronic
1091019229 11:132083676-132083698 GTTGAGCTTGATTCCTTAAATGG + Intronic
1095572991 12:43703826-43703848 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
1097427911 12:59470255-59470277 GTTGAGGCTGACTCCTCACATGG + Intergenic
1097499996 12:60389795-60389817 GTCAAGCTTGACTCCTTACAGGG + Intergenic
1097844233 12:64350498-64350520 GTCAAGCTTGACTCCTTAAAGGG - Intronic
1097949432 12:65410759-65410781 GTTGAGAGAGATTACTTAAAAGG + Intronic
1098436251 12:70471080-70471102 GTCAAGCTTGACCCCTTAAAGGG - Intergenic
1098805729 12:75017939-75017961 GTCAAGCTTGACTCCTTAAAGGG + Intergenic
1099001411 12:77182088-77182110 GTTGAGCTTGACTCCTTAAAGGG + Intergenic
1099121923 12:78700836-78700858 GGTGAAATTGACACCTTAACAGG + Intergenic
1099535149 12:83833917-83833939 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1099604335 12:84783290-84783312 CTTGAGATAGCCTCCTGAAAAGG + Intergenic
1103842873 12:123879597-123879619 GTTGAGTTTGGGTCCTTAAGTGG + Intronic
1106086013 13:26542115-26542137 GCTGAGATTTACTGCTTCAAAGG + Intergenic
1106148926 13:27079249-27079271 CTTGAGATTGAATCCTTACCTGG - Intronic
1106179041 13:27355603-27355625 AATGAGATTGACGCATTAAAGGG + Intergenic
1106194333 13:27480435-27480457 GTTGAAATTTAATCCTCAAAGGG + Intergenic
1108203979 13:48070098-48070120 GTCGAGCTTGACTCCTTAAAGGG - Intronic
1108720300 13:53124798-53124820 GTTGCGACTCACTGCTTAAAGGG + Intergenic
1109012811 13:56972982-56973004 GTTGAGACTGACTCCTTAAAGGG - Intergenic
1109165666 13:59031169-59031191 GTTGAGATAGACTTTTAAAAAGG + Intergenic
1109293527 13:60502798-60502820 GTTGAGATTGACTCCTTAAAGGG + Intronic
1109388986 13:61668726-61668748 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1109784667 13:67157830-67157852 GTTGAGTTTGAAACCTTAATGGG + Intronic
1109865561 13:68259454-68259476 GTCAAGATCGACTCTTTAAAGGG - Intergenic
1110256890 13:73443047-73443069 GTTCAGCTTGACTCCTTAAAGGG - Intergenic
1110990851 13:82040400-82040422 GTCAAGATTGACTCCTTAAAGGG + Intergenic
1111028758 13:82568984-82569006 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
1111132754 13:83998309-83998331 GTCCAGATTGATTCCTTAAAGGG - Intergenic
1116230671 14:42211675-42211697 GTGGAGATTGACTCCTTAAGTGG - Intergenic
1116390204 14:44382075-44382097 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1117103186 14:52371181-52371203 GTAGAGAAGGACTCCTGAAAAGG - Intergenic
1118550226 14:66941632-66941654 GTCAAGCTTGACTCCTGAAAGGG + Intronic
1120302773 14:82729458-82729480 GATGAGATTGAGAGCTTAAAAGG + Intergenic
1120314151 14:82870829-82870851 GTGGAGACTGACCCCTTAAAGGG - Intergenic
1123766071 15:23479643-23479665 GTTGAGATTGACTCCTTAAAGGG - Intergenic
1123927101 15:25126192-25126214 GTTGGGACTGACTGCTTAATGGG - Intergenic
1124791778 15:32734325-32734347 TTTTAGATTTTCTCCTTAAAAGG - Exonic
1125062355 15:35439546-35439568 GTTGAGCTTGATTCCTTAAAAGG - Intronic
1127785945 15:62354853-62354875 GTTGAGATCAAAACCTTAAACGG + Intergenic
1131250081 15:90824686-90824708 TTTGAGACTGATTCCATAAAAGG - Intergenic
1135036381 16:19081360-19081382 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
1135077371 16:19405056-19405078 GTCGAGATTGACTCCTTAAAGGG + Intergenic
1136352050 16:29716984-29717006 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
1137330449 16:47489763-47489785 GTTGAGCTTGACTCTTTAAAGGG + Intronic
1137895776 16:52210679-52210701 GTTAAGATTGACTCCAAAGATGG + Intergenic
1143534327 17:7527068-7527090 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1144228146 17:13172261-13172283 GTCAAGTTTAACTCCTTAAAGGG - Intergenic
1144593430 17:16544628-16544650 GTCAAGCTTGATTCCTTAAAAGG - Intergenic
1146039313 17:29435696-29435718 TTCGAGCTTGACTCCTTAAAGGG + Intronic
1147453988 17:40523404-40523426 GTGGAGAGGGATTCCTTAAAGGG - Intergenic
1149094654 17:52825872-52825894 GTCAAGCTTGACTCCTTAAAGGG + Intergenic
1149587885 17:57805284-57805306 TTTGAGATTGCTTTCTTAAAAGG + Intergenic
1152663394 17:81553197-81553219 CTTCAGATTGGCTTCTTAAACGG - Intronic
1155784723 18:29881809-29881831 GTCAAGATTGACTCCTTAAAGGG + Intergenic
1155867914 18:30989462-30989484 GAGGAGAATGACTGCTTAAAAGG + Intergenic
1156098332 18:33563015-33563037 GTTGAGCTTGTCTCCTTAAAGGG + Intergenic
1156698661 18:39797401-39797423 GCTGATATTGACTCCTTAAAGGG + Intergenic
1156877939 18:42038804-42038826 CTTGAAATTGACACCTTATAAGG + Exonic
1156972069 18:43169034-43169056 GTTGAGCTTGACTCCTTAAAGGG - Intergenic
1157653649 18:49363031-49363053 GTGGATATAGAATCCTTAAAAGG + Intronic
1157661730 18:49451360-49451382 GTGGAGGTTGACTCCTTAAAGGG - Intronic
1157821937 18:50778377-50778399 TTCGAGCTTAACTCCTTAAAGGG - Intergenic
1158016184 18:52786840-52786862 GTCGAGATTGACTCCTTAAAGGG + Intronic
1158152057 18:54384334-54384356 GTCAAGATTGACTTCTTAAAGGG + Intronic
1158641134 18:59205075-59205097 GCCAAGACTGACTCCTTAAAGGG - Intergenic
1158644007 18:59227914-59227936 GCCGAGAGTGACTGCTTAAAGGG + Intronic
1159309709 18:66691353-66691375 GTCGAGACTGATTCCTGAAAGGG - Intergenic
1159784244 18:72695240-72695262 GTCTAGATTGACTCCTTAAAGGG - Intergenic
1163704543 19:18804601-18804623 GTTGGGATTGACGTCTTGAAGGG - Intergenic
1164106530 19:22111318-22111340 GTTGAGCCTGATTCCTTAAAGGG + Intergenic
1164211798 19:23104729-23104751 GTCAAGCTTGACTCTTTAAAGGG - Intronic
1166418766 19:42617371-42617393 GTGAAGACTGACTCCTTCAAGGG - Intronic
1166531902 19:43547905-43547927 TTTGAGATTTTCCCCTTAAATGG - Intronic
926927318 2:18000880-18000902 GTCAAGCTTGATTCCTTAAAGGG - Intronic
927963915 2:27257587-27257609 GTTGGGATTGACTGCATTAATGG + Intronic
928738234 2:34318400-34318422 GTTGAGATTTAATCATTAGATGG + Intergenic
929657028 2:43744002-43744024 GTTGGGCTTGGCTCCTGAAAAGG - Intronic
932196840 2:69791294-69791316 GTTAAGCTTGATTCCTTAAAGGG + Intronic
933131138 2:78675053-78675075 GTCAAGATTAACTCCTTAAAGGG + Intergenic
935556596 2:104516557-104516579 GTTGAGATTAACTGCATAAATGG + Intergenic
936839885 2:116756728-116756750 GTTGAGACTGACTCTTTAAAGGG - Intergenic
937478362 2:122235340-122235362 ATTGATATGGACACCTTAAAAGG - Intergenic
938661126 2:133488428-133488450 GTTGAGATTTACTCACTAATTGG - Intronic
940786842 2:157990382-157990404 CTTGAAATTGCCTCATTAAAAGG + Intronic
941853724 2:170209097-170209119 GTCGAGCTTGACTCCTTAAAGGG + Intronic
942839177 2:180339155-180339177 GGCTAGATTGACTCCTTAAAGGG - Intergenic
943419887 2:187657226-187657248 GTCAAGATTGACTCTTTAAAGGG - Intergenic
945632738 2:212302909-212302931 GAGGAGATTCACTCCTGAAAAGG + Intronic
946297414 2:218796161-218796183 GTCGAGCTTGACTCCTTAAAGGG + Intronic
946604354 2:221386637-221386659 GTTGAGATTGACTGGATATAAGG - Intergenic
948964926 2:241371606-241371628 AGTGAGATTAACTCTTTAAAAGG + Intronic
1172269109 20:33643218-33643240 ATGGAGACTGACTCCTTTAAGGG - Intronic
1174765940 20:53254368-53254390 GTTGGGACTGGCTCCTTCAAAGG - Exonic
1177414683 21:20778266-20778288 GTTGAGCTTGGTTTCTTAAAGGG + Intergenic
1177567648 21:22845152-22845174 GTAGAGCTTGACTCCTTAAAGGG + Intergenic
1178619754 21:34163251-34163273 ATCGAGATTGACTCCTTAAAGGG + Intergenic
1181446595 22:22981023-22981045 GTCAAGATTGACTCCTTAAAGGG - Intergenic
1181837371 22:25621938-25621960 GTTAAGCTTGATTCCTTAAAGGG + Intronic
949812242 3:8018061-8018083 TTTGAGCTTGACTCCTTAAAGGG + Intergenic
950210029 3:11116455-11116477 GTTGAGATTGGCTCTTAAAGGGG - Intergenic
950248422 3:11443081-11443103 TTTGAAATTGACTCCTCAAAAGG + Intronic
951345747 3:21545692-21545714 GTCGAACTTGACTCCTTATAGGG - Intronic
952193169 3:31045464-31045486 GTTGAGATTGACTCCTTAAAGGG - Intergenic
952454384 3:33458798-33458820 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
952637284 3:35547084-35547106 GTTGCACTTGACTCCTTAAAGGG + Intergenic
953647741 3:44770581-44770603 GTCAAGCTTGACTCCTTAAAAGG + Intronic
954025896 3:47782506-47782528 GTTCAGATTCACTGCTTCAAAGG + Intergenic
955613116 3:60778807-60778829 GTTGAGCTTGACTCCTTAAAGGG - Intronic
957574384 3:81989406-81989428 GTCAAGACTGACTCCTTAAAAGG - Intergenic
957952433 3:87143834-87143856 GTCAAGCTTTACTCCTTAAAGGG - Intergenic
958536441 3:95410614-95410636 GTCAAGCTTGACTCCTTAAAGGG - Intergenic
958744115 3:98112600-98112622 GTTGAGATTGACTCCTTAAAAGG - Intergenic
959342676 3:105150174-105150196 GATGAAATGCACTCCTTAAATGG + Intergenic
959424750 3:106172986-106173008 GTGCAGATTGACTCATTAACAGG - Intergenic
959431442 3:106259627-106259649 GTCGGGATTGACTCCTTAAAGGG - Intergenic
960373072 3:116864700-116864722 GTTGAGCGTTACTCTTTAAAAGG + Intronic
962404897 3:135092389-135092411 GCCAAGATGGACTCCTTAAAGGG - Intronic
963173152 3:142271451-142271473 GTAGAGAATGACTTCTTAATGGG + Intergenic
964980132 3:162668410-162668432 TTCAAGATTGACTCCTTAAAGGG - Intergenic
965027956 3:163327204-163327226 GTTGACATTGACTCCTTAAAAGG - Intergenic
966688085 3:182717445-182717467 GTCAAGCCTGACTCCTTAAAGGG + Intergenic
967531302 3:190551243-190551265 GTTGAGCTTGACTCCTTAAAGGG + Intronic
967542418 3:190683161-190683183 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
968381235 4:98582-98604 GTCAAGCTTAACTCCTTAAAGGG - Intergenic
968729799 4:2264366-2264388 GGTGAGGGTGAGTCCTTAAATGG - Intergenic
971158441 4:24108047-24108069 GTTGTGATTGACTGTTTACAAGG + Intergenic
971599988 4:28580623-28580645 TTTGACATTGACACCTTTAAAGG + Intergenic
972216129 4:36899007-36899029 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
972973952 4:44610444-44610466 GTTGAGCTGGACCCCTTACAGGG + Intergenic
974665507 4:64956244-64956266 GTCGAGATTGACTCCTTAAAGGG - Intergenic
974674975 4:65077785-65077807 GTCGAGATTGACTCCTTAAAAGG - Intergenic
975891805 4:79038249-79038271 GTTAACAGTAACTCCTTAAATGG - Intergenic
977631419 4:99247693-99247715 GAACAGACTGACTCCTTAAATGG - Intergenic
978019670 4:103792117-103792139 GTCAAGATTGACTCCTTAGAAGG - Intergenic
978328787 4:107588519-107588541 GTTGAGCTTGACTCCTTAAAGGG + Intergenic
979015214 4:115423894-115423916 GTTAAGCTTGATTCCTTAAAGGG - Intergenic
979874521 4:125871409-125871431 GTTGAGATTTATTACTGAAAGGG - Intergenic
980301407 4:130999303-130999325 TTTTAGATTGGCTCCTTAAAGGG - Intergenic
980642778 4:135601417-135601439 GTCAAGATTGATTCCTTAAAGGG - Intergenic
980722744 4:136719300-136719322 GTCAAACTTGACTCCTTAAAGGG - Intergenic
981324469 4:143429686-143429708 GTAGAGCTTGACTCCTTAAAGGG + Intronic
981770462 4:148302604-148302626 GTTGAGCTTGATTCCTTAAAGGG - Intronic
982477854 4:155874523-155874545 GTTGAGCTTGACTCCTTAAAAGG + Intronic
982756819 4:159230024-159230046 GTTGAGATTGAATTGTTGAAAGG + Intronic
983915176 4:173283757-173283779 GTCGAACTTGACTCTTTAAAGGG + Intronic
984125588 4:175805473-175805495 GTTCATATTGTCTCCTAAAAGGG - Intronic
984569850 4:181378962-181378984 TTTGAAACTGACTCCTTTAATGG - Intergenic
986213573 5:5697406-5697428 GTCGAGCTTGACTCCTTTAAGGG - Intergenic
986479659 5:8174013-8174035 GTTGAGATTTTCTCATTACATGG - Intergenic
987890237 5:23867028-23867050 GTCGAGCTTGACTCCTTAAATGG - Intergenic
988157605 5:27475590-27475612 GTTGAGCTTGACTGCTTAAAGGG - Intergenic
988899856 5:35720009-35720031 GTAGAGATTTACTCCTTAAAGGG + Intronic
989255280 5:39359590-39359612 ATTGAGATTGATTCAGTAAAAGG + Intronic
989692104 5:44157097-44157119 TTTGAGCTTGAGTCCTTAAAGGG - Intergenic
989715373 5:44456053-44456075 GTCAAGCTTGACTACTTAAAGGG + Intergenic
990198732 5:53347563-53347585 GGTGAGATTGATTTCCTAAATGG - Intergenic
990284853 5:54291089-54291111 GTTGAGATTGTCTAATTAATAGG - Intronic
991014152 5:61913919-61913941 GTCAAGCTTGACTCCTTAAAGGG - Intergenic
991620537 5:68540431-68540453 ATTGAGATTGCTTCCTCAAAGGG - Intergenic
994360176 5:98841055-98841077 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
994505620 5:100640201-100640223 GTCAAAATTGACTCCTTAAAGGG - Intergenic
995314273 5:110750066-110750088 GTTGGGATTTAGTCCTTACAGGG + Intronic
995357757 5:111258932-111258954 GTTGAGATTTACTTCCTTAAGGG - Intronic
995393695 5:111665306-111665328 ATCTAGATTGACTCCTGAAAGGG + Intronic
995830162 5:116346104-116346126 GTCAAAATTGACTCCTTAAAGGG + Intronic
995882335 5:116857151-116857173 TTGGAGATTGACCCCATAAAGGG + Intergenic
996574348 5:124965550-124965572 GTCGCGCTTGACTCCTTAAAGGG - Intergenic
997491420 5:134280109-134280131 GTTGAGATCAGCTCCTTTAAAGG + Intergenic
997672024 5:135683101-135683123 GTTGAGATTGACGCCACAAATGG - Intergenic
997706548 5:135959403-135959425 GTTGTCATTGACTGATTAAAGGG - Intergenic
997838293 5:137214942-137214964 GTTAATATTTACTCCTTAATTGG + Intronic
998345437 5:141457947-141457969 GTCAAGCTTGATTCCTTAAAGGG + Intronic
999008042 5:148004373-148004395 GTTGAGATTGACTCCTTAAAGGG - Intergenic
1000069683 5:157728276-157728298 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
1000585521 5:163093208-163093230 GATAAGATTGTCTCCTTGAATGG + Intergenic
1005119565 6:22375054-22375076 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
1005181270 6:23109573-23109595 TTTGAGATTGTCTCCTTAAAGGG + Intergenic
1005637256 6:27764296-27764318 GTTGAGATTGCCACCATTAAAGG - Intergenic
1008839756 6:55888153-55888175 GTTTAGATTGCTTCCTTATATGG - Intergenic
1009657346 6:66563908-66563930 GTCAAGATTAACACCTTAAATGG + Intergenic
1009908057 6:69892804-69892826 GTTGAGATTGACTCCTTAAAGGG + Intronic
1010103948 6:72145732-72145754 GTCAAGCTTGATTCCTTAAAGGG + Intronic
1010453465 6:76029048-76029070 GTTGAGATTGACTCCTTAAAGGG - Intronic
1010541513 6:77098012-77098034 GTCGAAATTGACTCCTTAAAGGG - Intergenic
1010670671 6:78682567-78682589 GTTGAGCTTGACTCCCCAAAGGG + Intergenic
1010872632 6:81060913-81060935 GCCAAGTTTGACTCCTTAAAGGG + Intergenic
1011563685 6:88650082-88650104 GATAAGAATGACTCCTAAAAGGG + Intronic
1012115638 6:95294287-95294309 GTTGAAAGTGACTACCTAAAAGG - Intergenic
1012594802 6:101027049-101027071 GTCGAGCTTGACTCCTTAAAGGG - Intergenic
1012694019 6:102354848-102354870 GTCGAGATTGACTCCTTAAAGGG + Intergenic
1014954796 6:127601228-127601250 GTTAAGCTTGACTCTTTAAAGGG + Intergenic
1015031013 6:128595991-128596013 ATTGAAATTGACTACTCAAAAGG + Intergenic
1015813265 6:137181960-137181982 GTTGAGCTTGATTCCTTAAAGGG + Intergenic
1016162201 6:140895655-140895677 GTAGAGTTTGACTCCTTAAAGGG + Intergenic
1016181262 6:141150725-141150747 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
1016216220 6:141607380-141607402 GTTTAGATAGACTACTCAAAGGG + Intergenic
1017343614 6:153355257-153355279 GTTGAGCTTGATTTCCTAAAGGG - Intergenic
1020070113 7:5221793-5221815 GTTGGGATTGACTCCTTATAAGG + Intronic
1020350358 7:7212328-7212350 GTCAAGCTTGATTCCTTAAAGGG + Intronic
1020677044 7:11195562-11195584 GTTAAGATTGACTCCTTAAAAGG - Intergenic
1021331358 7:19342485-19342507 GTCGAGCTTGACTCCTTAAAGGG - Intergenic
1021648049 7:22806186-22806208 GTTGAGCTTCACTCCTTAAAGGG - Intergenic
1023582821 7:41700391-41700413 GTTGTGATTGCCTTTTTAAAAGG + Exonic
1023719134 7:43074792-43074814 GTCAAAATTGACTCCTTAAAGGG + Intergenic
1023782269 7:43668092-43668114 GTCAAGCTTGATTCCTTAAAGGG - Intronic
1024437859 7:49380425-49380447 GTTGAGCTTGACTTTTTAACAGG - Intergenic
1024491329 7:49989179-49989201 GTCGAGCTTGATTCCTTAAAGGG - Intronic
1025157642 7:56623740-56623762 GTTGAGATTGACTCCTTAAAGGG - Intergenic
1025758111 7:64364309-64364331 GTTGAGCTTGACTCCATAAAGGG + Intergenic
1028352123 7:89861893-89861915 GTTGAGATTCACTCCTTAAAGGG - Intergenic
1030727878 7:112947592-112947614 AATGAGATTGACACCTCAAAGGG - Intergenic
1031834916 7:126671069-126671091 GTCAAGATTGACTCCTTAAAGGG - Intronic
1032251265 7:130259916-130259938 GTTGAGCGTGATTCCTTAAAGGG - Intergenic
1033865941 7:145690749-145690771 GTTGAGCTTGACTCCCTAAAGGG - Intergenic
1034231639 7:149534081-149534103 GTGAAGCTTGATTCCTTAAAGGG - Intergenic
1036537600 8:9665680-9665702 GTTAACAGTGACTCCTGAAAAGG - Intronic
1037111316 8:15167282-15167304 GTCTAGATTGACACCTTAAAGGG - Intronic
1038742073 8:30224888-30224910 GGTGAGAGTGTCTCCTTGAAGGG + Intergenic
1039184069 8:34897451-34897473 GTCAAGATTGACTCCTTAAAAGG - Intergenic
1039392283 8:37190994-37191016 GTTGATATTGACACTGTAAATGG - Intergenic
1040374242 8:46807701-46807723 GTTGAGCTTGACTCCTCAAAGGG + Intergenic
1040526652 8:48231629-48231651 GTTGAGATTGACTCCTTAAAGGG - Intergenic
1041911989 8:63098805-63098827 GTCGAGCTTGACTCCTTAAAAGG - Intergenic
1042415270 8:68511013-68511035 GTTGAGATTGACTCCTTAAAGGG + Intronic
1043513299 8:80971037-80971059 CTTTAGACTTACTCCTTAAAAGG + Exonic
1044888275 8:96803607-96803629 TTTGAGGTTGATTCCATAAAAGG + Intronic
1046068229 8:109221192-109221214 GTCAAGATTGACTCCCTAAAGGG - Intergenic
1047581419 8:126219846-126219868 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
1048686833 8:136913340-136913362 GTCAAGGTTGATTCCTTAAAAGG + Intergenic
1050018851 9:1263119-1263141 CTTGAGAATCCCTCCTTAAAAGG + Intergenic
1050189256 9:3007988-3008010 ATTGAAATTGACTATTTAAAAGG - Intergenic
1051219708 9:14835457-14835479 GTCGAGCTTGATTCCTTAAAGGG - Intronic
1052059563 9:23943505-23943527 GTTGAGCTTGACTCCTTAAAGGG + Intergenic
1052616905 9:30853507-30853529 ATCGAGAATGACTCCTTAAAGGG - Intergenic
1058282168 9:103129048-103129070 GTTGAGCTTGACTCCTTAAAGGG + Intergenic
1061815016 9:133189305-133189327 GTGGAGAGTGACTGCTTAATGGG + Intergenic
1186658481 X:11642794-11642816 GTGGAGAATGACTGCTTAATGGG + Intronic
1188159227 X:26779834-26779856 GTCAAGCTTGATTCCTTAAAGGG + Intergenic
1188442067 X:30222673-30222695 GAGGAGATTGGCTCCTTAACAGG + Intergenic
1188571565 X:31591904-31591926 GTTGAGATAAACTCCTTAGGAGG - Intronic
1188763070 X:34056313-34056335 GTCAAGACTGACCCCTTAAAGGG - Intergenic
1189153196 X:38728832-38728854 GTCGAGCTTGACTCCTTAAAGGG - Intergenic
1189616681 X:42790958-42790980 GTTGAGCTTGACTTCTTAAAGGG + Intergenic
1190129614 X:47735013-47735035 CATGAGATTGACTTCCTAAATGG - Intergenic
1190490846 X:50981714-50981736 GCCAAGCTTGACTCCTTAAAGGG - Intergenic
1190549081 X:51560078-51560100 ATCAAGCTTGACTCCTTAAAGGG + Intergenic
1191189734 X:57654146-57654168 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
1191644836 X:63468721-63468743 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1192681296 X:73256260-73256282 GTTGAGATTGACTCCTTAAAGGG + Intergenic
1192765516 X:74136111-74136133 GTCAAGCTTGATTCCTTAAAAGG - Intergenic
1192777285 X:74258503-74258525 GTCAAGCTTGATTCCTTAAAGGG - Intergenic
1193228908 X:79019874-79019896 GTTGAGATTGACTCCTTAAAGGG - Intergenic
1193328726 X:80212822-80212844 GTTGAGATTGTGTCCTAAAATGG - Intergenic
1193347888 X:80425058-80425080 GTTAAGCTTGACTTCTTAAAGGG + Intronic
1193791281 X:85818308-85818330 GTCAAGATTGATTCCTTAAAGGG - Intergenic
1193833776 X:86317948-86317970 GTCAAGCTTGACTCCTTAAAGGG + Intronic
1193945264 X:87725936-87725958 GTTGAGACTGACTCCTTAAAGGG + Intergenic
1194066544 X:89268406-89268428 GTTGAGCTTGACTCTTCAAAGGG + Intergenic
1194147980 X:90287069-90287091 GTCAAGTTTGATTCCTTAAAGGG - Intergenic
1195275837 X:103279449-103279471 ATTGAGAATGACTGCTTAATGGG - Intergenic
1197262020 X:124330039-124330061 GTGGAAATTGATTCCATAAAGGG + Intronic
1197365943 X:125564505-125564527 GTCAAGATTGTCTCCTTAAAGGG + Intergenic
1197772079 X:130095586-130095608 GTTGACATTGAGTCCTTGAGGGG - Intronic
1198557667 X:137812459-137812481 AGTGAGATTGACTCATCAAAAGG + Intergenic
1198939518 X:141938121-141938143 GTTGAGCTTGACTCCTTAAAGGG - Intergenic
1199169598 X:144720631-144720653 GTCAAGCTTGACTCCTTAAAGGG - Intergenic
1199234012 X:145470454-145470476 GTCGAGATTGACTCTTTAAAGGG - Intergenic
1200494359 Y:3863828-3863850 GTCAAGTTTGATTCCTTAAAGGG - Intergenic
1200720712 Y:6602527-6602549 GTTGAGCTTGACTCTTCGAAGGG + Intergenic
1200860047 Y:7981698-7981720 GTTGAACTTGACTCCTTACAGGG - Intergenic
1200898471 Y:8402783-8402805 GTTGAGCTTGACTCCTTAAAGGG - Intergenic
1201319840 Y:12686504-12686526 GTCAAGTTTGATTCCTTAAAGGG - Intergenic
1201320681 Y:12694917-12694939 GTCAAGCTTGATTCCTTAAAAGG + Intergenic
1202259204 Y:22951901-22951923 GTTGATCTTGACTCCTTAAAGGG + Intergenic
1202270511 Y:23067790-23067812 GTTGAGCTTGACTGCTTAAAGGG + Intergenic
1202295516 Y:23352892-23352914 GTTGAGCTTGACTGCTTAAAGGG - Intergenic
1202412190 Y:24585645-24585667 GTTGATCTTGACTCCTTAAAGGG + Intergenic
1202423505 Y:24701534-24701556 GTTGAGCTTGACTGCTTAAAGGG + Intergenic
1202447284 Y:24968551-24968573 GTTGAGCTTGACTGCTTAAAGGG - Intergenic
1202458590 Y:25084423-25084445 GTTGATCTTGACTCCTTAAAGGG - Intergenic