ID: 1025157643

View in Genome Browser
Species Human (GRCh38)
Location 7:56623741-56623763
Sequence AGTTGAGATTGACTCCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 18, 1: 22, 2: 57, 3: 74, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025157643_1025157644 2 Left 1025157643 7:56623741-56623763 CCTTTAAGGAGTCAATCTCAACT 0: 18
1: 22
2: 57
3: 74
4: 333
Right 1025157644 7:56623766-56623788 CAGAGCCAGTAAGCACCCCTTGG No data
1025157643_1025157645 3 Left 1025157643 7:56623741-56623763 CCTTTAAGGAGTCAATCTCAACT 0: 18
1: 22
2: 57
3: 74
4: 333
Right 1025157645 7:56623767-56623789 AGAGCCAGTAAGCACCCCTTGGG No data
1025157643_1025157647 12 Left 1025157643 7:56623741-56623763 CCTTTAAGGAGTCAATCTCAACT 0: 18
1: 22
2: 57
3: 74
4: 333
Right 1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025157643 Original CRISPR AGTTGAGATTGACTCCTTAA AGG (reversed) Intergenic
900676199 1:3888071-3888093 AGTGGAGAATGACACCTTCAGGG + Intergenic
904709706 1:32420570-32420592 AGTCAAGATTGACTCCTTAAAGG - Intergenic
906410628 1:45575984-45576006 ACTCGAGCTTGACTGCTTAAAGG + Intergenic
906563123 1:46774709-46774731 AGTCAAGTTTGATTCCTTAAAGG - Intronic
909863404 1:80636361-80636383 AGGAGAGATTGACTCCTTAAAGG - Intergenic
909916642 1:81327648-81327670 ATTTGATATTGACTTTTTAAAGG - Intronic
910626704 1:89314944-89314966 AGTTGAGCTTGACTCTTTAAAGG + Intergenic
911299471 1:96154513-96154535 AGTTGAGCTTGACTCCTTTAAGG + Intergenic
911576862 1:99588276-99588298 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
912111376 1:106346730-106346752 AGTCAAGATTGACTCCTTAAAGG + Intergenic
913025065 1:114829973-114829995 AGTTGAGCTTGACTCTTTAAAGG + Intergenic
913030652 1:114899045-114899067 AGTCAAGTTTGACTGCTTAAAGG + Intronic
913103333 1:115590597-115590619 AGTTGAACTTGACTCCTTAAAGG - Intergenic
913551896 1:119924454-119924476 AGTTGGGATTCACTCTTGAAAGG - Intronic
915211992 1:154317083-154317105 AGTCAAGTTTGATTCCTTAATGG - Intergenic
915672528 1:157502455-157502477 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
916954415 1:169816796-169816818 AGTCAAGTTTGATTCCTTAAAGG + Intronic
917556856 1:176099699-176099721 AGTCGAGCTTGACTCCTTAAAGG - Intronic
918175196 1:182037368-182037390 AGTCGAGCTTGACTCTTTAAAGG + Intergenic
919280579 1:195483851-195483873 AGTCGAATTTGACTCCTTAAAGG + Intergenic
920421227 1:205835146-205835168 ATCTGAGATGGACTCCTTAGTGG + Intronic
921179765 1:212622960-212622982 AATGAAGAGTGACTCCTTAATGG - Intergenic
921535842 1:216348301-216348323 AGTCAAGATTGATTCCTTAAAGG - Intronic
921680160 1:218021928-218021950 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
923241583 1:232090273-232090295 ACCAGAGATTGAATCCTTAAAGG + Intergenic
923412922 1:233727479-233727501 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
923914125 1:238483341-238483363 AGTCAAGATTGACTCCGTAAAGG + Intergenic
924929533 1:248716622-248716644 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1063318271 10:5027957-5027979 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1063332159 10:5170722-5170744 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
1064175339 10:13070444-13070466 AGTCAAGCTTGACTCCTTAAAGG - Intronic
1064341615 10:14490718-14490740 AGTTGAGATTAAGACCTTAAAGG - Intergenic
1065151604 10:22827984-22828006 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1065678377 10:28203084-28203106 AGTTGATATTGACTCCTGCCAGG - Intronic
1067326817 10:45276447-45276469 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1068736573 10:60419943-60419965 AGTGGAGATTGAATCCTAACAGG - Intronic
1071012552 10:80954983-80955005 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1071392123 10:85185850-85185872 AGTTAAGTTTAATTCCTTAAAGG + Intergenic
1071689526 10:87802225-87802247 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1071833405 10:89394822-89394844 AGTAGGGAGTGACTGCTTAATGG - Intronic
1071926323 10:90414288-90414310 AGTCGAGATTGACTCCTTAAAGG - Intergenic
1073531377 10:104235348-104235370 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1073574457 10:104610888-104610910 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1074149850 10:110748858-110748880 AGGAGAGAGTGACTGCTTAATGG - Intronic
1074545858 10:114402162-114402184 AGTTGAGATTGAATAGTTATTGG - Intronic
1075491691 10:122876790-122876812 AGTTGTGATTGACTTCTAAGTGG + Intronic
1076217154 10:128704261-128704283 AGTGGAGAGTGACTGTTTAATGG - Intergenic
1077534619 11:3117186-3117208 AGTCAAGTTTGAGTCCTTAAAGG - Intronic
1077942079 11:6853801-6853823 AGTGAAGTTTGATTCCTTAAAGG - Intergenic
1078599144 11:12715339-12715361 AGTTGAGCAGGACTCCTTGAGGG + Intronic
1079412755 11:20205391-20205413 AGTTAAGTTTGATTCCTTAAAGG - Intergenic
1079417951 11:20257752-20257774 AGATGAGATTAACTCATTCAAGG + Intergenic
1080058279 11:27930050-27930072 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1081042140 11:38225654-38225676 AGTTGGGGTTGATTCCTTAGAGG + Intergenic
1082202372 11:49388076-49388098 AGGTAAGATTGACTCCTCAATGG - Intergenic
1082228527 11:49736908-49736930 AGCTGAGATTCACTCTTTAAAGG + Intergenic
1082656156 11:55859631-55859653 AGTCGAGATTGACTCTTTAAAGG - Intergenic
1082737304 11:56871148-56871170 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1082949251 11:58792799-58792821 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1082951966 11:58826988-58827010 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1082961519 11:58922582-58922604 ATTTGAGCTTGACTCCTCAGGGG + Intronic
1083949301 11:65945320-65945342 AGTTCAGTTTGGCTCCTTCAGGG + Intergenic
1084878084 11:72148772-72148794 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1085566928 11:77522386-77522408 AGTTGAGCTTGACTCCTTAAAGG + Intronic
1086621547 11:88892240-88892262 AGCTGAGATTGACTCTTTAAAGG - Intronic
1087047427 11:93853815-93853837 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1087432067 11:98067235-98067257 AGTGGAGATTGACTCCTTAAAGG + Intergenic
1087486073 11:98761349-98761371 AGTTGAGATTGACTCCCCAAAGG - Intergenic
1087971810 11:104493549-104493571 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1089488601 11:118866802-118866824 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1090291382 11:125548183-125548205 GGTACAGGTTGACTCCTTAAAGG + Intergenic
1092214698 12:6672779-6672801 TGATGAGATTGACTACTTTAAGG - Intronic
1092509605 12:9140853-9140875 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1092585917 12:9900796-9900818 AGTCGAGATTGACTCCTTAAAGG + Intronic
1093735703 12:22618005-22618027 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
1094100362 12:26755758-26755780 AGTCAAGTTTGAGTCCTTAAAGG - Intronic
1094345778 12:29467097-29467119 AGATGATAATGACTCCATAATGG + Intronic
1094641095 12:32276228-32276250 AGTTGAGATTTCCTCCGGAAGGG - Intronic
1095102155 12:38196549-38196571 AATTATGATTGACTCCTTGAAGG + Intergenic
1095122121 12:38431944-38431966 TGTAGAAAATGACTCCTTAAGGG + Intergenic
1095266291 12:40162039-40162061 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1095270471 12:40212955-40212977 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1096671881 12:53204575-53204597 AGTGGGGAATGACTGCTTAATGG + Intronic
1096870586 12:54589834-54589856 AGTTGAGGCTGACACCTTAGAGG - Intergenic
1097338744 12:58413934-58413956 AGTCAAGTTTGACTCCTTAAAGG + Intergenic
1097499995 12:60389794-60389816 AGTCAAGCTTGACTCCTTACAGG + Intergenic
1097844234 12:64350499-64350521 AGTCAAGCTTGACTCCTTAAAGG - Intronic
1098436252 12:70471081-70471103 AGTCAAGCTTGACCCCTTAAAGG - Intergenic
1098805728 12:75017938-75017960 AGTCAAGCTTGACTCCTTAAAGG + Intergenic
1099001410 12:77182087-77182109 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1099535148 12:83833916-83833938 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1101563869 12:105886405-105886427 AGTTGAGAGTGACTGCTAATGGG + Intergenic
1101689998 12:107068730-107068752 AATAGAGAGTGATTCCTTAATGG - Intronic
1102080642 12:110095194-110095216 AATGGAGAGGGACTCCTTAATGG - Intergenic
1102775071 12:115511554-115511576 AGTTGGGATTAATTCCATAAGGG - Intergenic
1105757718 13:23484435-23484457 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1106179040 13:27355602-27355624 AAATGAGATTGACGCATTAAAGG + Intergenic
1107311688 13:39085385-39085407 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1108061068 13:46534140-46534162 AGCAAAGATTGACCCCTTAATGG + Intergenic
1108203980 13:48070099-48070121 AGTCGAGCTTGACTCCTTAAAGG - Intronic
1108720299 13:53124797-53124819 AGTTGCGACTCACTGCTTAAAGG + Intergenic
1109012812 13:56972983-56973005 AGTTGAGACTGACTCCTTAAAGG - Intergenic
1109293526 13:60502797-60502819 AGTTGAGATTGACTCCTTAAAGG + Intronic
1109388985 13:61668725-61668747 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1109422920 13:62137346-62137368 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1109784666 13:67157829-67157851 AGTTGAGTTTGAAACCTTAATGG + Intronic
1109865562 13:68259455-68259477 AGTCAAGATCGACTCTTTAAAGG - Intergenic
1109876321 13:68408453-68408475 AATTGAGATTGAATGTTTAATGG + Intergenic
1110256891 13:73443048-73443070 AGTTCAGCTTGACTCCTTAAAGG - Intergenic
1110457197 13:75702574-75702596 ACTTGAGAATTACCCCTTAAAGG + Intronic
1110990850 13:82040399-82040421 AGTCAAGATTGACTCCTTAAAGG + Intergenic
1111028757 13:82568983-82569005 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1111132755 13:83998310-83998332 AGTCCAGATTGATTCCTTAAAGG - Intergenic
1113172735 13:107523631-107523653 AGGAGAGATTGCCTTCTTAAGGG + Intronic
1113524282 13:110962322-110962344 AATTAAGCTTGATTCCTTAAAGG - Intergenic
1113898332 13:113780242-113780264 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1114053113 14:18940311-18940333 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1114109445 14:19461615-19461637 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1114940157 14:27599312-27599334 AGTTAAGATTCACTTGTTAATGG + Intergenic
1116233636 14:42249895-42249917 AGTTGACATTAAGTCTTTAAGGG - Intergenic
1116390203 14:44382074-44382096 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1118118529 14:62809361-62809383 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1118510761 14:66470621-66470643 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1118535554 14:66759355-66759377 AGTCAAACTTGACTCCTTAAAGG + Intronic
1118550225 14:66941631-66941653 AGTCAAGCTTGACTCCTGAAAGG + Intronic
1118870981 14:69741350-69741372 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1118938751 14:70313126-70313148 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1118961987 14:70542366-70542388 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1118999312 14:70866855-70866877 AGTTGAGCTTGATTCCTTAAAGG + Intergenic
1120314152 14:82870830-82870852 AGTGGAGACTGACCCCTTAAAGG - Intergenic
1120705817 14:87744373-87744395 AGTTGAAATTGACTCATTTTTGG - Intergenic
1121462326 14:94090722-94090744 AGTCAAGTTTGATTCCTTAAGGG + Intronic
1122186521 14:100001822-100001844 AGTTAAGTTTGATTCCTTAAAGG + Intronic
1122433708 14:101677078-101677100 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1122591775 14:102857728-102857750 AGTCAAGTTTGAGTCCTTAAAGG + Intronic
1123766072 15:23479644-23479666 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1123927102 15:25126193-25126215 AGTTGGGACTGACTGCTTAATGG - Intergenic
1124876027 15:33594196-33594218 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1125923917 15:43545921-43545943 AGCCGGGATTGACTTCTTAATGG - Intronic
1128149246 15:65352427-65352449 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1130678993 15:85980055-85980077 AATGGAGAGTGACTGCTTAAGGG + Intergenic
1133617141 16:7487862-7487884 AATTGAGATTGACTGTTAAAAGG - Intronic
1134081817 16:11330004-11330026 AGTAGAGAATGACTGCTTAATGG - Intronic
1135036382 16:19081361-19081383 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1135077370 16:19405055-19405077 AGTCGAGATTGACTCCTTAAAGG + Intergenic
1137330448 16:47489762-47489784 AGTTGAGCTTGACTCTTTAAAGG + Intronic
1137453094 16:48595725-48595747 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1138149605 16:54644030-54644052 AGTTGAGAGTAACAGCTTAATGG - Intergenic
1138424752 16:56923661-56923683 AGTGGGGATTTACTGCTTAATGG - Intergenic
1138634713 16:58328485-58328507 AATGGAGAATGACTGCTTAATGG + Intronic
1140015704 16:71181591-71181613 AGTTAAGACTGATTGCTTAATGG - Intronic
1140047273 16:71449477-71449499 AGTTGAGAGTCACACCTAAAGGG + Exonic
1140057209 16:71536030-71536052 AGTTGGAATTGTCTCCTCAAAGG - Intronic
1140459504 16:75128083-75128105 AGTGAAGTTTGATTCCTTAAAGG - Intergenic
1140536019 16:75710747-75710769 AGTCAAGCTTGATTCCTTAAAGG - Intronic
1143534326 17:7527067-7527089 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1144228147 17:13172262-13172284 AGTCAAGTTTAACTCCTTAAAGG - Intergenic
1144402316 17:14918115-14918137 AGTGGAGATAAACTCCTTCATGG + Intergenic
1144555348 17:16277195-16277217 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1146039312 17:29435695-29435717 CTTCGAGCTTGACTCCTTAAAGG + Intronic
1148518408 17:48244384-48244406 AGGGGAGATTGACGCCATAAAGG + Intronic
1149034526 17:52119366-52119388 AGTCAAGCTTGATTCCTTAACGG - Intronic
1149094653 17:52825871-52825893 AGTCAAGCTTGACTCCTTAAAGG + Intergenic
1149106507 17:52973679-52973701 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1149483865 17:57025763-57025785 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1150972520 17:70044809-70044831 AGTTGACATTGATTCTTTATTGG + Intergenic
1151347869 17:73514387-73514409 AGTTGAGATTGGCTTCTGTATGG - Intronic
1155688716 18:28589235-28589257 AGTTGTGATTGTCTCCTTTCTGG - Intergenic
1155784722 18:29881808-29881830 AGTCAAGATTGACTCCTTAAAGG + Intergenic
1155883188 18:31176190-31176212 AGTTAAGATGGAGTCTTTAAGGG - Intergenic
1156098331 18:33563014-33563036 AGTTGAGCTTGTCTCCTTAAAGG + Intergenic
1156698660 18:39797400-39797422 AGCTGATATTGACTCCTTAAAGG + Intergenic
1156971759 18:43165553-43165575 AGTCAAGATTGACTCCTTAAAGG - Intergenic
1156972070 18:43169035-43169057 AGTTGAGCTTGACTCCTTAAAGG - Intergenic
1157661731 18:49451361-49451383 AGTGGAGGTTGACTCCTTAAAGG - Intronic
1157821938 18:50778378-50778400 ATTCGAGCTTAACTCCTTAAAGG - Intergenic
1157912835 18:51635326-51635348 AGTAAAGTTTGATTCCTTAAAGG - Intergenic
1158016183 18:52786839-52786861 AGTCGAGATTGACTCCTTAAAGG + Intronic
1158152056 18:54384333-54384355 AGTCAAGATTGACTTCTTAAAGG + Intronic
1158641135 18:59205076-59205098 AGCCAAGACTGACTCCTTAAAGG - Intergenic
1158767312 18:60469255-60469277 AGTTCAGTTTGATTCATTAATGG + Intergenic
1159309710 18:66691354-66691376 AGTCGAGACTGATTCCTGAAAGG - Intergenic
1159551964 18:69904481-69904503 TCTTGAGATTGGCTCCTGAAAGG + Intronic
1159784245 18:72695241-72695263 AGTCTAGATTGACTCCTTAAAGG - Intergenic
1164106529 19:22111317-22111339 AGTTGAGCCTGATTCCTTAAAGG + Intergenic
1164211799 19:23104730-23104752 AGTCAAGCTTGACTCTTTAAAGG - Intronic
1166249113 19:41553779-41553801 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1166418767 19:42617372-42617394 AGTGAAGACTGACTCCTTCAAGG - Intronic
1166900757 19:46060032-46060054 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1168478583 19:56697516-56697538 AGTGGAGAGTTATTCCTTAATGG - Intergenic
924972761 2:144234-144256 AGTTAAGTTTGATTCCTAAAAGG + Intergenic
926114128 2:10200760-10200782 AGTCAAGTTTGATTCCTTAAAGG + Intronic
926615373 2:14991906-14991928 AGTAGAGAGTGAGTCCTTGAGGG - Intergenic
928672500 2:33616805-33616827 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
931857819 2:66322304-66322326 AATAGAGATTAACTGCTTAATGG + Intergenic
932196839 2:69791293-69791315 AGTTAAGCTTGATTCCTTAAAGG + Intronic
933131137 2:78675052-78675074 AGTCAAGATTAACTCCTTAAAGG + Intergenic
933614145 2:84466255-84466277 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
933634792 2:84696876-84696898 AGTTTAGACTGACTTTTTAATGG + Intronic
935024825 2:99266811-99266833 AGTCAAGTTTGATTCCTTAAAGG - Intronic
935153255 2:100459143-100459165 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
936469575 2:112786795-112786817 AGATGACAGTGACTCATTAAGGG - Intergenic
936839886 2:116756729-116756751 AGTTGAGACTGACTCTTTAAAGG - Intergenic
937878875 2:126850316-126850338 AGCTGGGCTTGACTCCTTGAAGG - Intergenic
939843628 2:147218093-147218115 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
940196601 2:151101883-151101905 AGTTGAAAATGACTCCTGTATGG + Intergenic
940987969 2:160067413-160067435 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
941853723 2:170209096-170209118 AGTCGAGCTTGACTCCTTAAAGG + Intronic
942839178 2:180339156-180339178 AGGCTAGATTGACTCCTTAAAGG - Intergenic
943419888 2:187657227-187657249 AGTCAAGATTGACTCTTTAAAGG - Intergenic
943666151 2:190610535-190610557 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
945869556 2:215212341-215212363 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
946297413 2:218796160-218796182 AGTCGAGCTTGACTCCTTAAAGG + Intronic
946701121 2:222415207-222415229 AGTCAAGTTTGACTCCTCAAAGG - Intergenic
947287829 2:228537302-228537324 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
949029111 2:241780942-241780964 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1171317597 20:24209230-24209252 AGTTGAGTTTAACTCCTCATTGG - Intergenic
1171384136 20:24756226-24756248 AGTTGAGATGCACTTTTTAAAGG - Intergenic
1171506296 20:25637162-25637184 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1172800848 20:37575053-37575075 AGTTGAGTTGGACTCTTTATGGG + Intergenic
1173943364 20:46931039-46931061 AGGTGAGTTTGACTCCCTGAGGG - Intronic
1174985802 20:55450393-55450415 AGTTGATTTTGACTCCTTTTGGG + Intergenic
1177414682 21:20778265-20778287 AGTTGAGCTTGGTTTCTTAAAGG + Intergenic
1177567647 21:22845151-22845173 AGTAGAGCTTGACTCCTTAAAGG + Intergenic
1178201973 21:30417695-30417717 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1178619753 21:34163250-34163272 AATCGAGATTGACTCCTTAAAGG + Intergenic
1178628094 21:34235056-34235078 AATGGGGATTGACTGCTTAATGG + Intergenic
1179168247 21:38952221-38952243 ACTGGAGATTGATTGCTTAATGG - Intergenic
1179956608 21:44743917-44743939 AATCGAGCTTGACTCCTTAAAGG - Intergenic
1180471586 22:15662686-15662708 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1181446596 22:22981024-22981046 GGTCAAGATTGACTCCTTAAAGG - Intergenic
1181723840 22:24797349-24797371 AGTTGAGATTGTCTATTTATGGG + Intergenic
1181837370 22:25621937-25621959 TGTTAAGCTTGATTCCTTAAAGG + Intronic
1183113631 22:35672439-35672461 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1185405905 22:50650572-50650594 AGTCGAGTTGGATTCCTTAAAGG - Intergenic
949812241 3:8018060-8018082 ATTTGAGCTTGACTCCTTAAAGG + Intergenic
949855900 3:8460828-8460850 AGTTGTGGTTGACTTTTTAATGG - Intergenic
950210030 3:11116456-11116478 GGTTGAGATTGGCTCTTAAAGGG - Intergenic
950600003 3:14025720-14025742 AGTCAAGTTTGATTCCTTAAAGG + Intronic
950919110 3:16676305-16676327 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
951345748 3:21545693-21545715 AGTCGAACTTGACTCCTTATAGG - Intronic
951678741 3:25272523-25272545 AGTTGAGAATTACTGCCTAAGGG - Intronic
952193170 3:31045465-31045487 AGTTGAGATTGACTCCTTAAAGG - Intergenic
952454383 3:33458797-33458819 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
952637283 3:35547083-35547105 AGTTGCACTTGACTCCTTAAAGG + Intergenic
953294771 3:41703969-41703991 AGTTGATTTTGACACCTTCATGG - Intronic
954359652 3:50113866-50113888 AGTTGAGATAAGATCCTTAATGG + Intronic
955007105 3:54979291-54979313 AGTCAAGTTTGATTCCTTAAAGG + Intronic
955613117 3:60778808-60778830 AGTTGAGCTTGACTCCTTAAAGG - Intronic
957952434 3:87143835-87143857 AGTCAAGCTTTACTCCTTAAAGG - Intergenic
958536442 3:95410615-95410637 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
959431443 3:106259628-106259650 AGTCGGGATTGACTCCTTAAAGG - Intergenic
959970356 3:112402039-112402061 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
960220221 3:115099034-115099056 ATTTGAAATGGACTTCTTAATGG - Intronic
960406194 3:117262758-117262780 ATTTGAAATTGAATCCTGAAGGG + Intergenic
962404898 3:135092390-135092412 AGCCAAGATGGACTCCTTAAAGG - Intronic
963173151 3:142271450-142271472 AGTAGAGAATGACTTCTTAATGG + Intergenic
964980133 3:162668411-162668433 ATTCAAGATTGACTCCTTAAAGG - Intergenic
965925143 3:173969569-173969591 ATTTGAGATAGACTTCTCAATGG - Intronic
966523475 3:180897579-180897601 AGTTGAGATTGACTCCTTAAAGG - Intronic
966688084 3:182717444-182717466 AGTCAAGCCTGACTCCTTAAAGG + Intergenic
966721483 3:183067107-183067129 AGTCAAGTTTGATTCCTTAAAGG - Intronic
966859671 3:184223276-184223298 AATAGAGAGTGACTGCTTAATGG + Intronic
967244819 3:187475976-187475998 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
967531301 3:190551242-190551264 AGTTGAGCTTGACTCCTTAAAGG + Intronic
968381236 4:98583-98605 AGTCAAGCTTAACTCCTTAAAGG - Intergenic
969727720 4:8933343-8933365 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
970711884 4:18873343-18873365 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
971693096 4:29863661-29863683 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
972670740 4:41212503-41212525 AGTTCACATTGGCTCCTTGAAGG + Intronic
972853461 4:43077210-43077232 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
972973951 4:44610443-44610465 AGTTGAGCTGGACCCCTTACAGG + Intergenic
974665508 4:64956245-64956267 AGTCGAGATTGACTCCTTAAAGG - Intergenic
974948446 4:68557796-68557818 AGTTAAGTTTGATTCCCTAAAGG - Intronic
974957470 4:68660196-68660218 AGTTAAGTTTGATTCCCTAAAGG - Intronic
974977208 4:68905896-68905918 ATTTGAGCTTGACTCCTCAGAGG + Intergenic
975205097 4:71636736-71636758 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
975317070 4:72966461-72966483 AATTGAGAGTGACTGCTAAATGG + Intergenic
975528215 4:75374211-75374233 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
975614391 4:76231903-76231925 AGTCAAGATTGACTCCTTAAAGG + Intronic
977590102 4:98816875-98816897 AGTTGAGTTTGATTCCTTAAAGG - Intergenic
977720345 4:100232361-100232383 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
978032482 4:103952328-103952350 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
978328786 4:107588518-107588540 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
979015215 4:115423895-115423917 AGTTAAGCTTGATTCCTTAAAGG - Intergenic
979024091 4:115545526-115545548 AGTCAAGTTTGAGTCCTTAAAGG + Intergenic
979408340 4:120342392-120342414 AGTTGAGCTTAATTCTTTAATGG + Intergenic
979874522 4:125871410-125871432 AGTTGAGATTTATTACTGAAAGG - Intergenic
980071569 4:128247898-128247920 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
980301408 4:130999304-130999326 ATTTTAGATTGGCTCCTTAAAGG - Intergenic
980642779 4:135601418-135601440 AGTCAAGATTGATTCCTTAAAGG - Intergenic
980722745 4:136719301-136719323 AGTCAAACTTGACTCCTTAAAGG - Intergenic
980987821 4:139712794-139712816 AGTCAAGTTTGATTCCTTAAAGG + Intronic
981324468 4:143429685-143429707 AGTAGAGCTTGACTCCTTAAAGG + Intronic
981770463 4:148302605-148302627 AGTTGAGCTTGATTCCTTAAAGG - Intronic
983011989 4:162558594-162558616 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
983561987 4:169110664-169110686 ATCTGTGGTTGACTCCTTAAGGG + Intronic
983915175 4:173283756-173283778 AGTCGAACTTGACTCTTTAAAGG + Intronic
984031663 4:174612141-174612163 AGTCCAGTTTGATTCCTTAAAGG - Intergenic
984170490 4:176352615-176352637 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
984441532 4:179777094-179777116 AGTGAAGTTTGATTCCTTAAAGG - Intergenic
984985577 4:185325904-185325926 AGTCAAGTTTGATTCCTTAAAGG + Intronic
985226972 4:187771768-187771790 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
986213574 5:5697407-5697429 AGTCGAGCTTGACTCCTTTAAGG - Intergenic
987007668 5:13726840-13726862 AGCCCAGGTTGACTCCTTAAGGG - Intronic
987165956 5:15198120-15198142 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
987678502 5:21106344-21106366 AGTCAAGTTTGATTCCTTAAGGG + Intergenic
987787637 5:22523016-22523038 TGCTGAAATTGACTTCTTAAGGG + Intronic
988157606 5:27475591-27475613 AGTTGAGCTTGACTGCTTAAAGG - Intergenic
988181208 5:27796678-27796700 AGTTGAGATTGTGTCCTCATGGG - Intergenic
988769716 5:34420284-34420306 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
988899855 5:35720008-35720030 AGTAGAGATTTACTCCTTAAAGG + Intronic
989692105 5:44157098-44157120 ATTTGAGCTTGAGTCCTTAAAGG - Intergenic
989715372 5:44456052-44456074 AGTCAAGCTTGACTACTTAAAGG + Intergenic
991014153 5:61913920-61913942 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
991239760 5:64444389-64444411 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
991265020 5:64707476-64707498 GGTTAAGCTTGATTCCTTAAAGG + Intronic
993600608 5:89919140-89919162 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
993979520 5:94528397-94528419 AGTTGAGAATGGCTCTTCAATGG + Intronic
993980915 5:94542918-94542940 AGTCAAGTTTGATTCCTTAAAGG - Intronic
994360175 5:98841054-98841076 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
994505621 5:100640202-100640224 AGTCAAAATTGACTCCTTAAAGG - Intergenic
995028587 5:107452786-107452808 AGTAGAAAATGACTCTTTAAAGG - Intronic
995197681 5:109391552-109391574 AGATGACATGGACTTCTTAATGG - Intronic
995393694 5:111665305-111665327 AATCTAGATTGACTCCTGAAAGG + Intronic
995830161 5:116346103-116346125 GGTCAAAATTGACTCCTTAAAGG + Intronic
996574349 5:124965551-124965573 AGTCGCGCTTGACTCCTTAAAGG - Intergenic
997767049 5:136515029-136515051 AATTGAATTTCACTCCTTAAGGG - Intergenic
999008043 5:148004374-148004396 AGTTGAGATTGACTCCTTAAAGG - Intergenic
999459313 5:151744158-151744180 AGTGGGGAGTGACTTCTTAATGG + Intronic
1000061227 5:157657908-157657930 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1000066637 5:157699056-157699078 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1002682486 5:180978154-180978176 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1002703642 5:181145663-181145685 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1005181269 6:23109572-23109594 ATTTGAGATTGTCTCCTTAAAGG + Intergenic
1006783542 6:36649276-36649298 AATGGAGAGTGACTGCTTAATGG + Intergenic
1008291264 6:49718600-49718622 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1009908056 6:69892803-69892825 AGTTGAGATTGACTCCTTAAAGG + Intronic
1010103947 6:72145731-72145753 AGTCAAGCTTGATTCCTTAAAGG + Intronic
1010453466 6:76029049-76029071 AGTTGAGATTGACTCCTTAAAGG - Intronic
1010454678 6:76041220-76041242 TGCTGTGATTAACTCCTTAATGG + Intronic
1010541514 6:77098013-77098035 AGTCGAAATTGACTCCTTAAAGG - Intergenic
1010670670 6:78682566-78682588 AGTTGAGCTTGACTCCCCAAAGG + Intergenic
1010810251 6:80292191-80292213 AGTTAAGTTTGATTCCTCAAAGG + Intronic
1010872631 6:81060912-81060934 AGCCAAGTTTGACTCCTTAAAGG + Intergenic
1010902979 6:81450680-81450702 AGTTGAGATTCATTGCTTTATGG + Intergenic
1012583581 6:100897078-100897100 AGTTGAACTTGACTCCTTAAAGG - Intergenic
1012594803 6:101027050-101027072 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1012694018 6:102354847-102354869 AGTCGAGATTGACTCCTTAAAGG + Intergenic
1013247717 6:108302677-108302699 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1013940902 6:115660614-115660636 AGGTGATATTGACCCCTTCAAGG - Intergenic
1014587431 6:123217000-123217022 AGTTTAGATTGTCACCTGAAGGG + Intronic
1014954795 6:127601227-127601249 AGTTAAGCTTGACTCTTTAAAGG + Intergenic
1015198708 6:130553808-130553830 AATGGTGATTGACTCCCTAAAGG - Intergenic
1015813264 6:137181959-137181981 AGTTGAGCTTGATTCCTTAAAGG + Intergenic
1016162200 6:140895654-140895676 GGTAGAGTTTGACTCCTTAAAGG + Intergenic
1016205933 6:141468175-141468197 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1016297012 6:142584255-142584277 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1017343615 6:153355258-153355280 AGTTGAGCTTGATTTCCTAAAGG - Intergenic
1017386175 6:153886340-153886362 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1017511803 6:155120879-155120901 AGTTGAGAATGACTGCTTTAAGG + Intronic
1017621549 6:156304448-156304470 AGTTGAGATAGACCACTTATGGG + Intergenic
1018078341 6:160236636-160236658 AGTTAAGTTTGATTTCTTAAAGG - Intronic
1018179811 6:161212960-161212982 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1018341984 6:162860633-162860655 AGTTGAGATTTAATATTTAATGG + Intronic
1018343155 6:162873312-162873334 AATACAGATTGACTCATTAATGG + Intronic
1018686728 6:166308875-166308897 ATTTGAAAGTGACTCCTCAAGGG - Intergenic
1019123082 6:169820646-169820668 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1021331359 7:19342486-19342508 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1021648050 7:22806187-22806209 AGTTGAGCTTCACTCCTTAAAGG - Intergenic
1022579908 7:31540909-31540931 AGTGAAGTTTGATTCCTTAAAGG + Intronic
1022663818 7:32390305-32390327 AGTTGAGAATCACTGCTTTAGGG - Intergenic
1022989843 7:35696145-35696167 AGTTGAGATTTCCTCCGTAGGGG - Intergenic
1023588407 7:41755094-41755116 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1023719133 7:43074791-43074813 AGTCAAAATTGACTCCTTAAAGG + Intergenic
1024013324 7:45289314-45289336 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
1024491330 7:49989180-49989202 AGTCGAGCTTGATTCCTTAAAGG - Intronic
1024595646 7:50933673-50933695 AAATGACACTGACTCCTTAACGG - Intergenic
1024935551 7:54708265-54708287 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1025039157 7:55624578-55624600 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1025157643 7:56623741-56623763 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1025634638 7:63311822-63311844 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1025648058 7:63436348-63436370 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1025758110 7:64364308-64364330 AGTTGAGCTTGACTCCATAAAGG + Intergenic
1025769078 7:64487204-64487226 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1028352124 7:89861894-89861916 AGTTGAGATTCACTCCTTAAAGG - Intergenic
1028828020 7:95296736-95296758 ATGTGAGACTGACTACTTAATGG - Intergenic
1029457643 7:100679142-100679164 AGTTGGAATTGGCTCCTTTATGG - Exonic
1030189684 7:106797926-106797948 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1030727879 7:112947593-112947615 AAATGAGATTGACACCTCAAAGG - Intergenic
1030782557 7:113619171-113619193 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1030884076 7:114917778-114917800 ATCTGGGAATGACTCCTTAAAGG + Intergenic
1031834917 7:126671070-126671092 AGTCAAGATTGACTCCTTAAAGG - Intronic
1032251266 7:130259917-130259939 AGTTGAGCGTGATTCCTTAAAGG - Intergenic
1033865942 7:145690750-145690772 AGTTGAGCTTGACTCCCTAAAGG - Intergenic
1034231640 7:149534082-149534104 AGTGAAGCTTGATTCCTTAAAGG - Intergenic
1034731939 7:153395515-153395537 AGTTAACATTGATTTCTTAAAGG - Intergenic
1036067457 8:5398234-5398256 AGATGAGATTGACTCCATAGTGG + Intergenic
1037111317 8:15167283-15167305 AGTCTAGATTGACACCTTAAAGG - Intronic
1037733076 8:21545431-21545453 AATGGAGAGTGACTGCTTAAGGG + Intergenic
1037955492 8:23054581-23054603 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1038742072 8:30224887-30224909 AGGTGAGAGTGTCTCCTTGAAGG + Intergenic
1038833704 8:31094307-31094329 AATAGGGAATGACTCCTTAATGG - Intronic
1040374241 8:46807700-46807722 AGTTGAGCTTGACTCCTCAAAGG + Intergenic
1040526653 8:48231630-48231652 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1040991012 8:53349348-53349370 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1041055143 8:53977629-53977651 ACTCAAGATTGTCTCCTTAAGGG - Intronic
1042367121 8:67950357-67950379 ACTTGAGTTTGAATCATTAATGG - Intergenic
1042415269 8:68511012-68511034 AGTTGAGATTGACTCCTTAAAGG + Intronic
1042831118 8:73029710-73029732 AGTTGAGATGGACAGCTTCATGG + Intronic
1044828413 8:96220829-96220851 AGTTGTGATTGTCTGCTTACTGG + Intergenic
1045428476 8:102090891-102090913 AGTCAAGTTTGATTCCTTAAAGG - Intronic
1046068230 8:109221193-109221215 AGTCAAGATTGACTCCCTAAAGG - Intergenic
1046228336 8:111316792-111316814 AGTTACTATTGACTTCTTAATGG - Intergenic
1046385453 8:113502843-113502865 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1046387771 8:113525694-113525716 AGTCAAGTTTGACTCCTTAAAGG - Intergenic
1049448527 8:142643712-142643734 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1050990370 9:12143584-12143606 AATTAAGTTTGATTCCTTAAAGG - Intergenic
1051219709 9:14835458-14835480 TGTCGAGCTTGATTCCTTAAAGG - Intronic
1051475259 9:17500315-17500337 ATTTGAGCTTGACTTTTTAAAGG + Intronic
1051859537 9:21608728-21608750 AGTAGAGAATGACTCATTTATGG + Intergenic
1052059562 9:23943504-23943526 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1052521436 9:29553025-29553047 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1052616906 9:30853508-30853530 AATCGAGAATGACTCCTTAAAGG - Intergenic
1052663488 9:31465775-31465797 AGTTAAGTTTGATTTCTTAAAGG + Intergenic
1052891737 9:33707328-33707350 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1055411069 9:76029843-76029865 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1056643610 9:88390784-88390806 GGTTGAAATTGACTCCTTACTGG + Intronic
1056677709 9:88690011-88690033 AGTTAAGTCTGATTCCTTAAAGG - Intergenic
1058282167 9:103129047-103129069 AGTTGAGCTTGACTCCTTAAAGG + Intergenic
1058986784 9:110215514-110215536 CGCTGAGAATGACTTCTTAATGG - Intergenic
1059243062 9:112824975-112824997 AATTGAGAGTGGTTCCTTAATGG - Intronic
1059743429 9:117177859-117177881 AGTTCAGATTTATTCCTGAAGGG - Intronic
1060016288 9:120089232-120089254 AGTTGAGAATCACTGCTTTAGGG - Intergenic
1061815015 9:133189304-133189326 GGTGGAGAGTGACTGCTTAATGG + Intergenic
1185727542 X:2434356-2434378 AGTTGACAATGACTCCTGAAAGG + Intronic
1185834926 X:3336548-3336570 AGTAGAGAATGACTGCTTCATGG + Intronic
1185837336 X:3357223-3357245 AATGGAGAGTGACTGCTTAATGG - Intergenic
1186658480 X:11642793-11642815 AGTGGAGAATGACTGCTTAATGG + Intronic
1187001029 X:15178447-15178469 AGTTCAGATTTTCTCCTTACTGG - Intergenic
1187720315 X:22143547-22143569 AATGGAGAGTGACTGCTTAATGG - Intronic
1188159226 X:26779833-26779855 AGTCAAGCTTGATTCCTTAAAGG + Intergenic
1188763071 X:34056314-34056336 AGTCAAGACTGACCCCTTAAAGG - Intergenic
1189153197 X:38728833-38728855 AGTCGAGCTTGACTCCTTAAAGG - Intergenic
1189616680 X:42790957-42790979 AGTTGAGCTTGACTTCTTAAAGG + Intergenic
1189632603 X:42970712-42970734 AGTTAAGCTTGATTCTTTAAAGG + Intergenic
1190149723 X:47935137-47935159 AGTTAAGTTTGATTCCTTAAAGG - Intronic
1190490847 X:50981715-50981737 AGCCAAGCTTGACTCCTTAAAGG - Intergenic
1190549080 X:51560077-51560099 AATCAAGCTTGACTCCTTAAAGG + Intergenic
1190955995 X:55194117-55194139 AGTCAAGTTTGACTCCTTAAAGG + Intronic
1191069682 X:56386672-56386694 AGTCAAGCTTGATTCCTTAAGGG + Intergenic
1191189735 X:57654147-57654169 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1191644835 X:63468720-63468742 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1192542413 X:71985371-71985393 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1192681295 X:73256259-73256281 AGTTGAGATTGACTCCTTAAAGG + Intergenic
1193228909 X:79019875-79019897 AGTTGAGATTGACTCCTTAAAGG - Intergenic
1193269576 X:79513888-79513910 AGTCAAGCTTGACTCCTTAAAGG - Intergenic
1193347887 X:80425057-80425079 AGTTAAGCTTGACTTCTTAAAGG + Intronic
1193531895 X:82664569-82664591 AGTAAAGTTTGATTCCTTAAAGG + Intergenic
1193791282 X:85818309-85818331 TGTCAAGATTGATTCCTTAAAGG - Intergenic
1193833775 X:86317947-86317969 AGTCAAGCTTGACTCCTTAAAGG + Intronic
1193945263 X:87725935-87725957 AGTTGAGACTGACTCCTTAAAGG + Intergenic
1194066543 X:89268405-89268427 AGTTGAGCTTGACTCTTCAAAGG + Intergenic
1194147981 X:90287070-90287092 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1194158336 X:90420386-90420408 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1194486108 X:94489175-94489197 AGTCAAGCTTGATTCCTTAAAGG - Intergenic
1194886761 X:99324843-99324865 ATTTGATATTAACTACTTAACGG + Intergenic
1195150603 X:102065725-102065747 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1195275838 X:103279450-103279472 AATTGAGAATGACTGCTTAATGG - Intergenic
1195550714 X:106166669-106166691 TGTGGATATTGACTCCTTATTGG - Intergenic
1195800585 X:108704691-108704713 ACTGGAGAGTGACTCCTTAATGG - Intergenic
1196102339 X:111859738-111859760 AGTCAAGTTTGATTCCTTAAAGG + Intronic
1196773040 X:119314895-119314917 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1197043069 X:121963723-121963745 AGTTAAGTTTGATTTCTTAAAGG - Intergenic
1197056794 X:122131266-122131288 ACTTGAAATTGTCTACTTAAAGG - Intergenic
1197062138 X:122194508-122194530 AGTTGTGATGGACTCCTGAAAGG - Intergenic
1197262019 X:124330038-124330060 AGTGGAAATTGATTCCATAAAGG + Intronic
1197354693 X:125423546-125423568 AATGGAGAGTGACTCCTTAATGG + Intergenic
1197365942 X:125564504-125564526 TGTCAAGATTGTCTCCTTAAAGG + Intergenic
1197568277 X:128115765-128115787 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
1197772080 X:130095587-130095609 GGTTGACATTGAGTCCTTGAGGG - Intronic
1198023610 X:132683159-132683181 AGTAGAGAAAGAGTCCTTAAGGG - Intronic
1198844598 X:140896890-140896912 AGTTAAATTTGATTCCTTAAAGG + Intergenic
1198939519 X:141938122-141938144 AGTTGAGCTTGACTCCTTAAAGG - Intergenic
1199169599 X:144720632-144720654 TGTCAAGCTTGACTCCTTAAAGG - Intergenic
1199234013 X:145470455-145470477 AGTCGAGATTGACTCTTTAAAGG - Intergenic
1199819473 X:151430563-151430585 AGTTGAGACTCAGTCCTTAGAGG - Intergenic
1199887272 X:152032660-152032682 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1200494360 Y:3863829-3863851 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1200504658 Y:3997350-3997372 AGTCAAGTTTGATTCCTTAAAGG + Intergenic
1200720711 Y:6602526-6602548 AGTTGAGCTTGACTCTTCGAAGG + Intergenic
1200852310 Y:7897100-7897122 AGTAGAACTTGACTCCTTAAAGG - Intergenic
1200860048 Y:7981699-7981721 AGTTGAACTTGACTCCTTACAGG - Intergenic
1200877630 Y:8175100-8175122 AGTTAAGTTTGATTCCTTAAAGG + Intergenic
1200898472 Y:8402784-8402806 AGTTGAGCTTGACTCCTTAAAGG - Intergenic
1201364185 Y:13185707-13185729 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1202086652 Y:21144772-21144794 AGTCAAGTTTGATTCCTTAAAGG - Intergenic
1202259203 Y:22951900-22951922 AGTTGATCTTGACTCCTTAAAGG + Intergenic
1202270510 Y:23067789-23067811 AGTTGAGCTTGACTGCTTAAAGG + Intergenic
1202295517 Y:23352893-23352915 AGTTGAGCTTGACTGCTTAAAGG - Intergenic
1202412189 Y:24585644-24585666 AGTTGATCTTGACTCCTTAAAGG + Intergenic
1202423504 Y:24701533-24701555 AGTTGAGCTTGACTGCTTAAAGG + Intergenic
1202447285 Y:24968552-24968574 AGTTGAGCTTGACTGCTTAAAGG - Intergenic
1202458591 Y:25084424-25084446 AGTTGATCTTGACTCCTTAAAGG - Intergenic