ID: 1025157647

View in Genome Browser
Species Human (GRCh38)
Location 7:56623776-56623798
Sequence AAGCACCCCTTGGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025157643_1025157647 12 Left 1025157643 7:56623741-56623763 CCTTTAAGGAGTCAATCTCAACT 0: 18
1: 22
2: 57
3: 74
4: 333
Right 1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG No data
1025157642_1025157647 13 Left 1025157642 7:56623740-56623762 CCCTTTAAGGAGTCAATCTCAAC 0: 18
1: 25
2: 60
3: 56
4: 175
Right 1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025157647 Original CRISPR AAGCACCCCTTGGGAAAAAC TGG Intergenic
No off target data available for this crispr