ID: 1025160720

View in Genome Browser
Species Human (GRCh38)
Location 7:56658088-56658110
Sequence CTATCCTTGAAAATAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025160720_1025160722 -10 Left 1025160720 7:56658088-56658110 CCCTGGGTTATTTTCAAGGATAG No data
Right 1025160722 7:56658101-56658123 TCAAGGATAGACCACATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025160720 Original CRISPR CTATCCTTGAAAATAACCCA GGG (reversed) Intergenic
No off target data available for this crispr