ID: 1025161745

View in Genome Browser
Species Human (GRCh38)
Location 7:56667183-56667205
Sequence CTGTCTCCACAGTTGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025161740_1025161745 -9 Left 1025161740 7:56667169-56667191 CCCTTGTGCCTGGTCTGTCTCCA No data
Right 1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG No data
1025161737_1025161745 5 Left 1025161737 7:56667155-56667177 CCCAGGTGATGCAACCCTTGTGC No data
Right 1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG No data
1025161738_1025161745 4 Left 1025161738 7:56667156-56667178 CCAGGTGATGCAACCCTTGTGCC No data
Right 1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG No data
1025161741_1025161745 -10 Left 1025161741 7:56667170-56667192 CCTTGTGCCTGGTCTGTCTCCAC No data
Right 1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG No data
1025161736_1025161745 11 Left 1025161736 7:56667149-56667171 CCAGCACCCAGGTGATGCAACCC No data
Right 1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025161745 Original CRISPR CTGTCTCCACAGTTGGAATT GGG Intergenic
No off target data available for this crispr