ID: 1025168638

View in Genome Browser
Species Human (GRCh38)
Location 7:56735953-56735975
Sequence TGAGAAGGAGTCGCCGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025168635_1025168638 0 Left 1025168635 7:56735930-56735952 CCACTTTTGTGTTTTTTATTTTT No data
Right 1025168638 7:56735953-56735975 TGAGAAGGAGTCGCCGAGGCTGG No data
1025168632_1025168638 13 Left 1025168632 7:56735917-56735939 CCACGGCACCCGGCCACTTTTGT No data
Right 1025168638 7:56735953-56735975 TGAGAAGGAGTCGCCGAGGCTGG No data
1025168633_1025168638 5 Left 1025168633 7:56735925-56735947 CCCGGCCACTTTTGTGTTTTTTA No data
Right 1025168638 7:56735953-56735975 TGAGAAGGAGTCGCCGAGGCTGG No data
1025168634_1025168638 4 Left 1025168634 7:56735926-56735948 CCGGCCACTTTTGTGTTTTTTAT No data
Right 1025168638 7:56735953-56735975 TGAGAAGGAGTCGCCGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025168638 Original CRISPR TGAGAAGGAGTCGCCGAGGC TGG Intergenic
No off target data available for this crispr