ID: 1025176318

View in Genome Browser
Species Human (GRCh38)
Location 7:56804152-56804174
Sequence GGCCACCGGGAGGCCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1089
Summary {0: 1, 1: 9, 2: 104, 3: 328, 4: 647}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025176318_1025176326 6 Left 1025176318 7:56804152-56804174 CCAGCTCCGGCCTCCCGGTGGCC 0: 1
1: 9
2: 104
3: 328
4: 647
Right 1025176326 7:56804181-56804203 GGTGCAACGCGTCCTCAATGAGG No data
1025176318_1025176327 7 Left 1025176318 7:56804152-56804174 CCAGCTCCGGCCTCCCGGTGGCC 0: 1
1: 9
2: 104
3: 328
4: 647
Right 1025176327 7:56804182-56804204 GTGCAACGCGTCCTCAATGAGGG No data
1025176318_1025176330 18 Left 1025176318 7:56804152-56804174 CCAGCTCCGGCCTCCCGGTGGCC 0: 1
1: 9
2: 104
3: 328
4: 647
Right 1025176330 7:56804193-56804215 CCTCAATGAGGGCCCCTCCAGGG No data
1025176318_1025176328 17 Left 1025176318 7:56804152-56804174 CCAGCTCCGGCCTCCCGGTGGCC 0: 1
1: 9
2: 104
3: 328
4: 647
Right 1025176328 7:56804192-56804214 TCCTCAATGAGGGCCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025176318 Original CRISPR GGCCACCGGGAGGCCGGAGC TGG (reversed) Intergenic
900013581 1:135057-135079 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
900013656 1:135397-135419 GGCCGTCGAGAGGACGGAGCTGG + Intergenic
900013695 1:135556-135578 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900013723 1:135656-135678 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900013852 1:136174-136196 GGCCACCGTGAGGGAGGAACAGG - Intergenic
900014152 1:137329-137351 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900014203 1:137495-137517 GGCCACCAGGAGGCAGGAGGTGG + Intergenic
900014269 1:137758-137780 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900014348 1:138051-138073 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
900014395 1:138260-138282 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900014540 1:138972-138994 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
900014558 1:139067-139089 GGCCACCGTGAGGCATAAGCTGG + Intergenic
900014593 1:139231-139253 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
900014625 1:139392-139414 GGCCACCAAGATGCAGGAGCTGG + Intergenic
900014678 1:139678-139700 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900043650 1:491040-491062 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
900043726 1:491380-491402 GGCCGTCGAGAGGACGGAGCTGG + Intergenic
900043765 1:491539-491561 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900043793 1:491639-491661 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900043922 1:492157-492179 GGCCACCGTGAGGGAGGAACAGG - Intergenic
900044015 1:492531-492553 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900044066 1:492697-492719 GGCCACCAGGAGGCAGGAGGTGG + Intergenic
900044132 1:492960-492982 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900044213 1:493253-493275 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
900044260 1:493462-493484 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900044405 1:494174-494196 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
900044424 1:494269-494291 GGCCACCGTGAGGCATAAGCTGG + Intergenic
900044459 1:494433-494455 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
900044492 1:494594-494616 GGCCACCAAGATGCAGGAGCTGG + Intergenic
900044545 1:494880-494902 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900044944 1:498287-498309 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900065088 1:726043-726065 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
900065164 1:726383-726405 GGCCGTCGAGAGGACGGAGCTGG + Intergenic
900065202 1:726542-726564 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
900065230 1:726642-726664 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900065359 1:727160-727182 GGCCACCGTGAGGGAGGAACAGG - Intergenic
900065425 1:727437-727459 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
900065476 1:727603-727625 GGCCACCAGGAGGCAGGAGGTGG + Intergenic
900065541 1:727866-727888 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900065621 1:728159-728181 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
900065668 1:728368-728390 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
900065812 1:729080-729102 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
900065830 1:729175-729197 GGCCACCGTGAGGCATAAGCTGG + Intergenic
900065896 1:729500-729522 GGCCACCAAGATGCAGGAGCTGG + Intergenic
900065949 1:729786-729808 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900066348 1:733195-733217 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900066744 1:736601-736623 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900067142 1:740017-740039 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
900195118 1:1372022-1372044 GAGCACCGGGAGGCTGGGGCAGG + Intergenic
900201107 1:1407058-1407080 GGCCAAGGGGCGGCCGGCGCGGG - Intronic
900473259 1:2864675-2864697 GGCATCCTGGAGGGCGGAGCTGG + Intergenic
900611339 1:3545814-3545836 GGCCAGCGGGAGGCTGGGGGAGG - Intronic
901259918 1:7863901-7863923 GGCCATCTGGAGGCTGGTGCTGG + Intergenic
901405220 1:9040550-9040572 GGCCACCAGGATGCCTGAACTGG + Intronic
901676570 1:10889010-10889032 GGCCCCTGGGCGGCCGGGGCGGG + Intergenic
903942009 1:26938370-26938392 GGCCAAAGGGAGGTGGGAGCAGG - Intronic
904603700 1:31687480-31687502 GGCCACGGGCAGGCCAGAGGAGG + Intronic
905253747 1:36666529-36666551 GGCCAGGGGGAGGCAGGAGTTGG - Intergenic
905628835 1:39507380-39507402 AGCCACTGGGAGGCAGCAGCAGG + Intronic
906483726 1:46218900-46218922 GGCCAAAAGGAGGCAGGAGCTGG - Intronic
906962107 1:50425148-50425170 GCCCACCGGGAGGCTGAGGCTGG + Intergenic
907278033 1:53327712-53327734 CGCGGCCGGGAGGCCGGAGCGGG - Intronic
907513304 1:54978343-54978365 GGCCAGTGAGAGGCAGGAGCAGG + Intergenic
909548025 1:76868634-76868656 GGCCACCGGCAGCTCGCAGCCGG + Exonic
911687352 1:100792538-100792560 GTCCACTGGGAGGCTGGAGAGGG + Intergenic
912526540 1:110287639-110287661 GGCCAACAGCAGGCCTGAGCTGG + Intergenic
914755362 1:150559037-150559059 GGCCAGGGGGAAGCAGGAGCAGG + Exonic
915120456 1:153627193-153627215 TGTCACCGGGAGACAGGAGCGGG - Intronic
915229275 1:154433568-154433590 GCCCAGCGGGAGACCAGAGCTGG + Intronic
915359869 1:155279389-155279411 GGACACAGGGAGGCCAGAGGAGG + Intronic
915552251 1:156642045-156642067 GGCCCCGGGGAGGGCGGGGCAGG + Exonic
915590526 1:156867917-156867939 GGCCATTGGGAGGCCGAGGCGGG - Intronic
916100599 1:161390280-161390302 GGGCGCGGAGAGGCCGGAGCCGG + Intergenic
917121917 1:171652227-171652249 GGGCACCCTGAGGCGGGAGCGGG - Exonic
917969279 1:180196843-180196865 GGCCAGCTGGAGGCCCGAGCTGG + Exonic
921039542 1:211416681-211416703 GGGCCCCGGGCGGCCGGAGCTGG + Intergenic
922099991 1:222472058-222472080 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
922100069 1:222472392-222472414 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
922100117 1:222472587-222472609 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
922100193 1:222472880-222472902 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
922100249 1:222473117-222473139 GGCCACCGAGAGCCATGAGCTGG + Intergenic
922100274 1:222473220-222473242 GGCCGCCGAGAGGATGGAGCTGG + Intergenic
922100326 1:222473415-222473437 GGCCACCGTGAGGCCTGACCTGG + Intergenic
922100404 1:222473708-222473730 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
922100451 1:222473917-222473939 GGCCGCCAGGAGGCATGAGCTGG + Intergenic
922100474 1:222474020-222474042 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
922100518 1:222474208-222474230 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
922100582 1:222474462-222474484 GGTCACCGTGAGGGAGGAGCTGG + Intergenic
922100808 1:222475757-222475779 GGCCACTGCAAGGCAGGAGCTGG + Intergenic
922100955 1:222476524-222476546 GGCCAACGTGAGGCATGAGCTGG + Intergenic
922100987 1:222476688-222476710 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
922101021 1:222476849-222476871 GGCCACCAAGATGCAGGAGCTGG + Intergenic
922101074 1:222477135-222477157 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
922196613 1:223364634-223364656 GGCCGCGCGGAGGCCGGGGCGGG - Intergenic
922262020 1:223951546-223951568 GGCCACTGGCAGGCAGTAGCTGG + Intergenic
922262068 1:223951755-223951777 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
922262173 1:223952273-223952295 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
922733630 1:227967984-227968006 GGCCACTGGGTGGCAGGAGTTGG - Intergenic
922733662 1:227968148-227968170 GGCCACCGTGAGGCATGAGCTGG - Intergenic
922733681 1:227968243-227968265 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
922733815 1:227968915-227968937 GGCCACTGCAAGGCAGGAGCTGG - Intergenic
922734047 1:227970214-227970236 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734110 1:227970468-227970490 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
922734155 1:227970657-227970679 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
922734175 1:227970720-227970742 GGCCGCCGAGAGGCCGTTGCTGG - Intergenic
922734200 1:227970823-227970845 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
922734245 1:227971032-227971054 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
922734325 1:227971324-227971346 GGCCACCGTGAGGCCTGACCTGG - Intergenic
922734438 1:227971753-227971775 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734484 1:227971934-227971956 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
922734613 1:227972456-227972478 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
922734726 1:227972885-227972907 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
922734765 1:227973065-227973087 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
922734899 1:227973598-227973620 GGCCACCGTGAGGCCTGACCTGG - Intergenic
922734927 1:227973697-227973719 GGCCGCCAGGAGGCCCAAGCTGG - Intergenic
922734945 1:227973760-227973782 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
922734971 1:227973856-227973878 GGCCGCCGAGAGGACGGAGTTGG - Intergenic
922735049 1:227974190-227974212 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
922917538 1:229271045-229271067 GCGCACGGGGAGGCCGGGGCGGG - Intronic
924343192 1:243053723-243053745 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
924343266 1:243054057-243054079 GGCCGCCGAGAGGACAGAGCTGG + Intergenic
924343291 1:243054153-243054175 GGCCGCCAGGAGGCCCAAGCTGG + Intergenic
924343319 1:243054252-243054274 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
924343447 1:243054771-243054793 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
924343479 1:243054904-243054926 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
924343531 1:243055070-243055092 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
924343592 1:243055348-243055370 GGCCACCGTGAGGCCTGACCTGG + Intergenic
924343669 1:243055641-243055663 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
924343713 1:243055834-243055856 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
924343861 1:243056546-243056568 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
924343880 1:243056641-243056663 GGCCACCGTGAGGCATAAGCTGG + Intergenic
924343914 1:243056805-243056827 AGCCACTGGGTGGCAGGAGCTGG + Intergenic
924343947 1:243056966-243056988 GGCCACCAAGATGCAGGAGCTGG + Intergenic
1066732417 10:38448258-38448280 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1066732451 10:38448422-38448444 GGCCACCGTGAGGCATGAGCTGG - Intergenic
1066732529 10:38448771-38448793 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1066733023 10:38450744-38450766 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1066733157 10:38451277-38451299 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1066733185 10:38451376-38451398 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1066733203 10:38451439-38451461 GGCCGCCAGGAGGCCGGAGCTGG - Intergenic
1066733225 10:38451535-38451557 GGCCGCCGAGAGGATGGAGCTGG - Intergenic
1066733297 10:38451847-38451869 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1067082416 10:43219168-43219190 GGCCAAGGGGAGGGGGGAGCAGG - Intronic
1067561695 10:47309011-47309033 AGCCCCAGGGAAGCCGGAGCTGG + Intronic
1067575477 10:47405961-47405983 GGGCACCTGGAGCTCGGAGCAGG - Intergenic
1068279886 10:54854770-54854792 GGCCACGGGCAGGCCAGAGAAGG + Intronic
1069264657 10:66443089-66443111 GGCCACAGGGAGGCTGGGGGAGG + Intronic
1069651472 10:70052964-70052986 GGGCACCGGGCGCCGGGAGCAGG + Exonic
1070846186 10:79524141-79524163 GGCCCCAGGAAGGCCGGGGCAGG - Intergenic
1070927612 10:80236169-80236191 GGCCCCAGGAAGGCCGGGGCAGG + Intergenic
1072650612 10:97292361-97292383 GGGCACCGGCAGGACCGAGCGGG + Intronic
1073010947 10:100359137-100359159 GGCCACCCAGAGGCTGGAGGTGG - Intronic
1073425300 10:103452214-103452236 GGCCTCCAGGAGGGCGGTGCAGG + Exonic
1074380052 10:112972030-112972052 GGCCAGCGGGAGGCTAAAGCAGG - Intronic
1075406356 10:122198371-122198393 GGACCTCGGGAGGCCGGAGCTGG - Intronic
1076116872 10:127907126-127907148 GGACAGCGGGCGGCAGGAGCCGG + Exonic
1076700709 10:132271237-132271259 TGCCACGTGGAGGCCGAAGCTGG - Intronic
1076820796 10:132938547-132938569 GCCCACCGGGAGGCCACAGAGGG + Intronic
1076969923 11:127271-127293 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1076970000 11:127611-127633 GGCCGTCGAGAGGACGGAGCTGG + Intergenic
1076970039 11:127770-127792 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1076970067 11:127870-127892 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1076970196 11:128388-128410 GGCCACCGTGAGGGAGGAACAGG - Intergenic
1076970352 11:129006-129028 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1076970401 11:129172-129194 GGCCACCAGGAGGCAGGAGGTGG + Intergenic
1076970466 11:129435-129457 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1076970545 11:129728-129750 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1076970592 11:129937-129959 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1076970736 11:130649-130671 GGCCACCAGGAGGCAGTAGTTGG + Intergenic
1076970754 11:130744-130766 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1076970789 11:130908-130930 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
1076970821 11:131069-131091 GGCCACCAAGATGCAGGAGCTGG + Intergenic
1076970875 11:131355-131377 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1076971273 11:134778-134800 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1077158965 11:1104015-1104037 GGCCACAGGCAGGCCTGGGCGGG - Intergenic
1079874461 11:25839152-25839174 AACCACCGGTAGCCCGGAGCAGG - Intergenic
1081528498 11:43942812-43942834 GCCCCCCGGGAGGCAGCAGCCGG - Exonic
1082009700 11:47441796-47441818 GGTCACCGGGATGCAGGGGCTGG - Intronic
1082259857 11:50070608-50070630 GGCCATCGTGAGACAGGAGCTGG + Intergenic
1082259948 11:50071167-50071189 GGCCACAGTGAGGCAAGAGCTGG + Intergenic
1082259975 11:50071338-50071360 GGCAGACGGGAGGCAGGAGCTGG + Intergenic
1082260047 11:50071693-50071715 GGCCAATGGGAGGCAGGAGCTGG + Intergenic
1082260064 11:50071756-50071778 GGTTGCCGGGAGGCCGGAGCTGG + Intergenic
1082260161 11:50072204-50072226 GGCCATCGGGAGGCAGGAGCTGG + Intergenic
1082260250 11:50072600-50072622 GGCCACCGGGAGGCAGGAGCTGG + Intergenic
1082260291 11:50072790-50072812 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1082260387 11:50073179-50073201 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1082260449 11:50073452-50073474 GGCCAATGGGAGGCAGGAGCTGG + Intergenic
1082260465 11:50073515-50073537 GGCTGCCGGGAGGCCAGAGATGG + Intergenic
1082260479 11:50073578-50073600 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1082260499 11:50073674-50073696 GGCCACTGTGAGGCCTGAGCTGG + Intergenic
1082260563 11:50073963-50073985 GGCCATCAGGAGGCAGGAGCTGG + Intergenic
1082260632 11:50074264-50074286 GGCCACTGAGAGGCAAGAGCTGG + Intergenic
1082260646 11:50074327-50074349 GTCCACCGGGAGGCTGCAGCTGG + Intergenic
1082260906 11:50075764-50075786 GGCCAACAGTAGGCAGGAGCTGG + Intergenic
1082261028 11:50076407-50076429 GGCCACCATGAGGCATGAGCTGG + Intergenic
1082261065 11:50076571-50076593 GGCCACTGAGTGGCAGGAGCTGG + Intergenic
1082261089 11:50076699-50076721 GGCCAACAGAAGGCAGGAGCTGG + Intergenic
1082261096 11:50076731-50076753 GGCCACCAAGATGCAGGAGCTGG + Intergenic
1082261126 11:50076889-50076911 GGCCACCATGAGGCATGAGCTGG + Intergenic
1082261205 11:50077309-50077331 GGTCATTGGGAGGCAGGAGCTGG + Intergenic
1082261268 11:50077656-50077678 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1082261340 11:50078014-50078036 GGCCACCTGGAAGCAGCAGCTGG + Intergenic
1082261361 11:50078109-50078131 GGCCACCCAGAGGCAGGAGCTGG + Intergenic
1082261455 11:50078550-50078572 GGCTGCTGGGAGGCGGGAGCTGG + Intergenic
1083237193 11:61358814-61358836 GGCCACTGAGAGGCCTGGGCAGG - Intronic
1083933689 11:65859539-65859561 GGCGGGCGGGAGGCGGGAGCCGG + Intronic
1084002797 11:66306625-66306647 AGCTACCGGGAGGCCGAGGCAGG + Intergenic
1084044080 11:66559198-66559220 CGCCACTGGGTGACCGGAGCCGG + Intronic
1084106826 11:66985925-66985947 GGCGACCTGGAGGATGGAGCAGG + Intergenic
1084174045 11:67414455-67414477 GGACATTGGGAGGCCGAAGCAGG + Intronic
1084274075 11:68042996-68043018 GGCCCCCGGGGGGCCGCACCAGG + Exonic
1084962092 11:72722257-72722279 AGCCTCCGGGAGACCAGAGCTGG - Intronic
1085261098 11:75205160-75205182 TCCCACAGGGAGGACGGAGCTGG + Exonic
1087626651 11:100603718-100603740 GGGCACCTGGAGGCCCCAGCTGG - Intergenic
1087785249 11:102347145-102347167 GGCGCCCGGGAGGCTGGGGCCGG - Intergenic
1089243059 11:117098243-117098265 GGTCCGCGGGAGGCCGGGGCTGG + Exonic
1089729650 11:120512065-120512087 GGCTGGCGGGAGGCGGGAGCGGG - Intronic
1090618591 11:128540846-128540868 GGCCACGGAGAGGCCAGACCAGG + Intronic
1090654246 11:128830728-128830750 GGCCTCCGGGAGACAGGAGCTGG + Intergenic
1090805725 11:130200938-130200960 GGCCACCGGCAAGCCAGAGCTGG - Intronic
1090915095 11:131156015-131156037 TGCCATCAGGTGGCCGGAGCCGG - Intergenic
1091420606 12:336592-336614 GAACACTGGGAGGCCGAAGCTGG + Intronic
1091760620 12:3084947-3084969 GGCCCCAGGGAGGCGGGAGGAGG - Intronic
1092111894 12:5970126-5970148 GGCCACAGGGAGTCAGGAGTGGG - Intronic
1094586547 12:31782337-31782359 CGCCACCGGCAGGCGGGAGGAGG + Intergenic
1096143840 12:49264726-49264748 GTCCACTGGGAGGAGGGAGCAGG - Intronic
1096541278 12:52308662-52308684 GGCTATTGGGAGGCCGGCGCGGG - Exonic
1098888612 12:75984913-75984935 GGTCAGCGGGAAACCGGAGCTGG - Intergenic
1099116159 12:78627042-78627064 GGCCACGAGGAGCCAGGAGCAGG + Intergenic
1100842993 12:98632098-98632120 GCACACTGGGAGGCCGAAGCAGG - Intronic
1101151395 12:101885816-101885838 GGCCACTGGGAGGCCGGACGCGG - Intronic
1101173058 12:102119931-102119953 GGGCCCCGGGAGGTGGGAGCGGG - Intronic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1103562637 12:121800397-121800419 GGCGACTGGGAGGTCGGACCTGG + Intronic
1103649462 12:122422115-122422137 GGACCCCGGGAGGCCGAAGCCGG - Intronic
1104021155 12:124993535-124993557 GGCTTCCGGGAGGCGGGCGCGGG + Intergenic
1104227366 12:126848649-126848671 GGCTTCCGAGATGCCGGAGCTGG - Intergenic
1104636853 12:130442840-130442862 GGCCACGGGGATGGAGGAGCTGG - Intronic
1104655573 12:130571828-130571850 GGCCACAGGGAGGCCAGTGTGGG - Intronic
1104751938 12:131245434-131245456 GGACTCCGGGAGGCTGGAGACGG + Intergenic
1104772411 12:131371769-131371791 GGCCAATGGGAGGCCTCAGCAGG - Intergenic
1104891381 12:132141791-132141813 GGCCACCTGCAGGGCTGAGCAGG + Intronic
1105274446 13:18906423-18906445 GGCCACTGGGTGGCAGGGGCTGG - Intergenic
1105515982 13:21091084-21091106 GGGCTTCGGGAGGCCGAAGCAGG - Intergenic
1106241960 13:27920099-27920121 GGGCACCGGGAGCCGGGAGCCGG - Exonic
1112766763 13:102753962-102753984 GGTCTCTGGGAGGCCGAAGCAGG + Intronic
1113906912 13:113823596-113823618 GGCCACAGTGAGGTCGGAGCAGG + Intronic
1114065383 14:19055020-19055042 GAGCACCGGGTGGCGGGAGCTGG + Intergenic
1114096879 14:19344982-19345004 GAGCACCGGGTGGCGGGAGCTGG - Intergenic
1114182113 14:20376103-20376125 GGCCACCGGGGGCCGGGATCGGG - Exonic
1114485251 14:23057937-23057959 GGGAACCGGGAGCCCGGAGCCGG - Intergenic
1115985798 14:39102944-39102966 GGGCACCGAGAGGGCAGAGCCGG + Intronic
1120928893 14:89827421-89827443 GGCTACCGGGCGGCCAGAGAAGG - Intronic
1121343412 14:93118034-93118056 GGGCGCTGGGAGGCCGAAGCAGG + Intergenic
1122288662 14:100667819-100667841 GGCGCCCGGGAGGCCGGAAGCGG + Intergenic
1122411273 14:101527350-101527372 GGCCACTGAGAGGCCTGAGAAGG + Intergenic
1123039216 14:105483554-105483576 GGCCCTGGGGAGGCCTGAGCTGG + Intergenic
1123739777 15:23225789-23225811 AGCCCCCAGGAGGCCGGTGCGGG + Intergenic
1124176091 15:27425356-27425378 GGCCACTGGGAGGCCGAGGCAGG + Intronic
1124291003 15:28454762-28454784 AGCCCCCGGGAGGCCGGTGCGGG + Intergenic
1124328033 15:28783834-28783856 GCACCCCGGGAGGCCGAAGCAGG - Intergenic
1124493632 15:30173494-30173516 GGCCACAGGAAGGGAGGAGCCGG - Intergenic
1124749936 15:32365155-32365177 GGCCACAGGAAGGGAGGAGCCGG + Intergenic
1129380532 15:75162537-75162559 GGACACTGGGAGGCCGAGGCAGG + Intergenic
1129450298 15:75647744-75647766 GGCCCGCGGGAGGGCGGAGCTGG + Intronic
1129644649 15:77419599-77419621 GGACGCGGGGAGGCCGGGGCAGG - Intronic
1129710802 15:77819493-77819515 GGCGAGCAGGAGGCAGGAGCGGG - Intronic
1130069497 15:80634625-80634647 GGGCACCAGGAGGCTGGTGCTGG + Intergenic
1130220195 15:82012966-82012988 GGACAACGGGAGGCTGGAGGAGG - Intergenic
1132114193 15:99123907-99123929 GGCCACCCGGCGTCCTGAGCAGG - Intronic
1132490730 16:229206-229228 GGCCGCCGGGCGGCCTGAGGCGG - Intronic
1132564791 16:616987-617009 GGCCACGGGCAGGGCGGGGCAGG - Intronic
1132660366 16:1058335-1058357 GGTCCCAGGGAGGCCGGCGCTGG + Intergenic
1132677206 16:1125755-1125777 GGCCAGCTGGAGCCCCGAGCAGG - Intergenic
1132708676 16:1257074-1257096 GGACAGCGGGAGGCCGGGCCAGG + Intronic
1132720593 16:1313805-1313827 GATCACCGGGAGGCGGGGGCAGG - Intronic
1132833981 16:1943285-1943307 GGCCTCCCGGAGGCGGAAGCCGG - Exonic
1132877774 16:2148081-2148103 GGTCACCGGGAGGACACAGCGGG - Intronic
1132900453 16:2251388-2251410 GGCCCTCGGGCGGACGGAGCGGG - Exonic
1133802188 16:9092524-9092546 GGACACCGGGTGGCCGGGCCCGG - Intronic
1134125357 16:11612544-11612566 GGCCAGCGGGCGGCCAGGGCCGG + Intronic
1135887118 16:26320324-26320346 GCCCACTGGGAGGCTGAAGCTGG + Intergenic
1136170766 16:28487803-28487825 GGCCAAGGAGAGGCAGGAGCTGG + Intronic
1138503339 16:57462845-57462867 GGGCGCCGGGAGGCCCAAGCCGG + Intronic
1139775061 16:69311649-69311671 GGCGAGGGGGCGGCCGGAGCGGG - Intronic
1139850885 16:69951137-69951159 GGCCAGGCCGAGGCCGGAGCAGG + Intronic
1139879867 16:70174049-70174071 GGCCAGGCCGAGGCCGGAGCAGG + Intronic
1140372652 16:74421499-74421521 GGCCAGGCCGAGGCCGGAGCAGG - Intronic
1141671760 16:85495847-85495869 GGCCTCCAGGAGGCTGGAGGTGG + Intergenic
1142082517 16:88157694-88157716 GGCCACCAGGAGCGGGGAGCTGG - Intergenic
1142448981 16:90162744-90162766 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1142449382 16:90166163-90166185 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1142449461 16:90166578-90166600 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1142449496 16:90166742-90166764 GGCCACCGTGAGGCATAAGCTGG - Intergenic
1142449514 16:90166837-90166859 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1142449656 16:90167545-90167567 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1142449704 16:90167754-90167776 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1142449783 16:90168047-90168069 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1142449849 16:90168310-90168332 GGCCACCAGGAGGCAGGAGGTGG - Intergenic
1142449898 16:90168476-90168498 GGCCATCGTGAGGGAGGAGCTGG - Intergenic
1142450481 16:90170744-90170766 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1142450610 16:90171262-90171284 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1142450638 16:90171362-90171384 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1142450679 16:90171521-90171543 GGCCGCCGAGAGGACGGAGCTGG - Intergenic
1142450756 16:90171861-90171883 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1142456809 17:61830-61852 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1142456886 17:62170-62192 GGCCGTCGAGAGGACGGAGCTGG + Intergenic
1142456924 17:62329-62351 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1142456952 17:62429-62451 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1142457081 17:62947-62969 GGCCACCGTGAGGGAGGAACAGG - Intergenic
1142457187 17:63370-63392 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1142457238 17:63536-63558 GGCCACCAGGAGGCAGGAGGTGG + Intergenic
1142457303 17:63799-63821 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1142457385 17:64091-64113 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1142457432 17:64300-64322 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1142457579 17:65012-65034 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1142457597 17:65107-65129 GGCCACCGTGAGGCATAAGCTGG + Intergenic
1142457631 17:65271-65293 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
1142457661 17:65432-65454 GGCCACCAAGATGCAGGAGCTGG + Intergenic
1142457714 17:65718-65740 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142458115 17:69138-69160 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142458509 17:72545-72567 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1142601210 17:1053791-1053813 GGCCAACGGGAAGCAGGAGAGGG + Intronic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1143096409 17:4480767-4480789 GGCCACAGGGAGCCCTGAGGTGG - Intronic
1143537360 17:7549251-7549273 GGCCAGCAGGAGGCCGAGGCAGG - Exonic
1144130353 17:12240767-12240789 GGGCTTTGGGAGGCCGGAGCAGG + Intergenic
1145935198 17:28711185-28711207 GCCCACCCGGACGCCGGGGCGGG - Intronic
1145974670 17:28977317-28977339 GGGCACAGGGTGGCCAGAGCGGG - Intronic
1146371156 17:32266203-32266225 GGCCACCGCGGGGCCCGGGCTGG - Exonic
1146757771 17:35448565-35448587 CTCCACCGGCTGGCCGGAGCTGG + Intronic
1147908264 17:43837654-43837676 GGACTCTGGGAGGCCGAAGCAGG + Intergenic
1147970982 17:44219091-44219113 GGCTCCCCGGAGGCCGGGGCGGG - Intronic
1148686924 17:49506235-49506257 GGCACCCGGGACGCAGGAGCTGG - Intronic
1150437861 17:65167969-65167991 GGCCACCGGGAGGATGAAGTGGG + Intronic
1151454667 17:74218677-74218699 GGAGACCGGGAGGCTGGAGGAGG + Intronic
1151509739 17:74550910-74550932 GGCCACACGCAGGCCGGACCAGG + Intergenic
1151701318 17:75744008-75744030 TGCCACAGGGTGGCAGGAGCAGG - Intronic
1151714595 17:75824985-75825007 GGCCTCAGGGAGGCCCGAGGGGG + Exonic
1151721044 17:75856041-75856063 CGCCACCGCGAGGCCGGAGAGGG - Intronic
1151911852 17:77088722-77088744 GACCACCAGGAGGCGAGAGCGGG - Intronic
1152070477 17:78131621-78131643 GGCCCCTGGGGTGCCGGAGCCGG + Exonic
1152350145 17:79779503-79779525 GCCTGCCGGGAGGCTGGAGCTGG + Intronic
1152595933 17:81237608-81237630 GGCCACAGGGAGGCTGCAGCAGG + Intronic
1152638323 17:81439265-81439287 TGACACCAGGAGGCTGGAGCAGG + Intronic
1152651887 17:81498800-81498822 ATCCTCCGGGAGGCTGGAGCAGG - Intergenic
1152667548 17:81580072-81580094 GAGCACTGGGAGGCAGGAGCTGG - Intronic
1152697663 17:81804817-81804839 GGCGCCGGGGGGGCCGGAGCCGG - Intronic
1152905987 17:82971301-82971323 AGACACCGTGAGGACGGAGCAGG + Intronic
1153031031 18:712774-712796 CGCCCCCGGGAGCCCGGAGCTGG - Intergenic
1153057316 18:958908-958930 GGCAACTGGGAGGGCTGAGCAGG + Intergenic
1154107328 18:11534002-11534024 GGCCACTGGGTGGCAGGGGCCGG - Intergenic
1154170304 18:12046575-12046597 GGCCACTGGGTGGCAGGGGCCGG + Intergenic
1157532172 18:48430256-48430278 GGCCACCAGGAGGGCGGCACAGG + Intergenic
1157558818 18:48632028-48632050 GGCAAACGGGAGGCAGGAGGTGG + Intronic
1157867279 18:51197476-51197498 GGCCGCCCGGAGACCGGAGAGGG + Intronic
1158341673 18:56473081-56473103 GGACTTCGGGAGGCCGAAGCGGG - Intergenic
1158648788 18:59269012-59269034 GGCCATCGGGAAGCCGTGGCAGG - Exonic
1158940427 18:62402323-62402345 TGCCACTAGGAGGCCGCAGCAGG + Intergenic
1159586779 18:70289356-70289378 GGAAACCGGGAAGCCGGGGCCGG + Intronic
1160589746 18:79936885-79936907 AGTAACCGGGAGGCCGGCGCTGG + Intronic
1160646725 19:197189-197211 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1160646798 19:197529-197551 GGCCGTCGAGAGGACGGAGCTGG + Intergenic
1160646837 19:197688-197710 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1160646865 19:197788-197810 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1160646994 19:198306-198328 GGCCACCGTGAGGGAGGAACAGG - Intergenic
1160647546 19:200475-200497 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1160647597 19:200641-200663 GGCCACCAGGAGGCAGGAGGTGG + Intergenic
1160647662 19:200904-200926 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1160647742 19:201197-201219 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1160647774 19:201358-201380 GGCCACCAAGATGCAGGAGCTGG + Intergenic
1160647827 19:201644-201666 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1160648226 19:205058-205080 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1160741306 19:687299-687321 GGCCACCATGAGGCCGGGTCAGG + Intronic
1160783705 19:890084-890106 GGCGACCCGGATCCCGGAGCAGG - Intronic
1160830713 19:1103873-1103895 AGCCAATGGGAGGCCGGAGTGGG - Intergenic
1160878320 19:1308241-1308263 GGCCCCTGGGAGGCCTGGGCAGG - Intergenic
1160899830 19:1422085-1422107 GGCCACGGGCAGCCCGGAGGCGG + Intronic
1160989462 19:1854551-1854573 GGGCACCAGGGCGCCGGAGCAGG + Exonic
1161150072 19:2702792-2702814 CGGCTGCGGGAGGCCGGAGCGGG + Intergenic
1161157431 19:2739934-2739956 GGCCCCCGGGAGGTAGGTGCGGG - Exonic
1161393204 19:4031918-4031940 GGGCACCGGGTAGCCAGAGCTGG + Intronic
1161510020 19:4665069-4665091 GGCCACCAGGAGGGCGGGGCAGG - Intronic
1162119730 19:8456250-8456272 TGCCACCAGGAGGCCCGAGGAGG + Intronic
1162940679 19:14007062-14007084 GGGGACCGGGAGGCGGGAGAAGG - Intergenic
1163123833 19:15233450-15233472 GGCCAGCAGGAGGACGGCGCCGG - Intergenic
1163234674 19:16023547-16023569 GGCCAGGGGGAGGCCTGGGCAGG - Intergenic
1163475068 19:17521084-17521106 GGCCAGAGGGACGCCGCAGCTGG + Exonic
1163666698 19:18606888-18606910 GGCGGCGGGGAGGCCGGTGCGGG - Intronic
1163793282 19:19320812-19320834 CGCCACAGGGAGGCGGAAGCAGG - Exonic
1164761512 19:30731790-30731812 GGCCACCAGGCTGCCGGAGCTGG - Intergenic
1165180470 19:33963192-33963214 GCCCACAGGGAGGCCTAAGCAGG + Intergenic
1165701981 19:37945344-37945366 AGCTACCGGGAGGCTGAAGCAGG - Intronic
1165900607 19:39167621-39167643 GGCCAGCGGGTGGTCAGAGCCGG - Intronic
1166010295 19:39936266-39936288 GGCCTCTGGGAGGCCAGAGCGGG + Intergenic
1166108657 19:40610032-40610054 GGTCAAAGGGAGGCTGGAGCTGG - Intronic
1166334283 19:42095987-42096009 GGCCAGTGGGCGGGCGGAGCGGG - Intronic
1166800032 19:45451037-45451059 GCCCGCCGGGAGCCCGGGGCGGG + Intronic
1167569317 19:50276932-50276954 GGCCACGGGGAGGGCAGGGCAGG + Intronic
1168107362 19:54173038-54173060 GCCCCCCGGGAGGCCAGAGGAGG - Exonic
1168270522 19:55247358-55247380 GGCGGCCGGGAGGCTGGAGATGG - Intronic
1168289670 19:55351487-55351509 GGAGGCCGGGAGGACGGAGCAGG + Intronic
1168353808 19:55690267-55690289 GGCCACAGGGAGGAGGGTGCAGG + Intronic
1168716716 19:58532945-58532967 AGCTACCGGGAGGCTGGGGCAGG - Intronic
925927197 2:8678968-8678990 GGCCGCGGCGGGGCCGGAGCCGG - Exonic
927667391 2:25042141-25042163 GGCCGCGGGCAGGACGGAGCCGG - Exonic
928840336 2:35598478-35598500 GGCCAGTGGGAGCCAGGAGCAGG + Intergenic
931106922 2:59066877-59066899 GGAGACAGAGAGGCCGGAGCCGG + Intergenic
931435280 2:62240541-62240563 AGCCACCGGGAGGCTGAGGCAGG + Intergenic
932415274 2:71569877-71569899 GGCCTCCGGGAAGCCGGGTCTGG - Exonic
932490393 2:72116297-72116319 GGCCACCTGCAGGCCAGAACAGG + Intergenic
932495456 2:72143800-72143822 GACCAAGAGGAGGCCGGAGCAGG + Intronic
934566621 2:95345233-95345255 GGCCTGCTGGAGTCCGGAGCGGG - Intronic
934717139 2:96550685-96550707 GGCCACCGAGAGGCCGAAGAAGG + Exonic
934721589 2:96581177-96581199 GCACTCCGGGAGGCCGAAGCAGG + Intergenic
936042146 2:109158261-109158283 GGCAACCGGGAGCCTGGAGGTGG - Intronic
936512216 2:113157496-113157518 GGCCCGCGGGAGGCCGGAGCAGG + Intronic
936512235 2:113157542-113157564 GACCACGGGGAGGCCTGGGCCGG + Intronic
937172096 2:119884009-119884031 GGCTACCGGGAGGCTGAGGCAGG - Intronic
937929282 2:127192089-127192111 GCTCACTGGGAGACCGGAGCTGG - Intronic
938482646 2:131674022-131674044 GAGCACCGGGTGGCGGGAGCTGG + Intergenic
938924205 2:136024375-136024397 CGCCATCCGCAGGCCGGAGCAGG - Intergenic
940227007 2:151410398-151410420 GGCCACCCTGAGGCCCGAACCGG - Exonic
942046665 2:172102847-172102869 GGGCTCTGGGAGGCGGGAGCAGG + Exonic
942446534 2:176082136-176082158 GCCCCCGGGGAGGCCAGAGCAGG + Intronic
942464074 2:176189382-176189404 GGCGGCAGGGAGGCCGGAGGCGG - Exonic
943645935 2:190408205-190408227 GGCGACTGTGAGGCCGGGGCCGG + Intergenic
944461662 2:199955997-199956019 GGCCACCGGGAGCCCTGGGCAGG - Exonic
944674473 2:202023613-202023635 GGCCACCGAGAGGCCAAAACTGG - Intergenic
944924862 2:204454147-204454169 GGGGACCGGGAGGCCGGGGGAGG + Intergenic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
946328279 2:218996182-218996204 GGCCACCAGAGGGCAGGAGCAGG + Intergenic
946865523 2:224038846-224038868 GCCCGCCGGGAGCCCCGAGCGGG - Intronic
947540983 2:230977935-230977957 TGCCACTGGGAGGCTGAAGCAGG - Intergenic
947610510 2:231522404-231522426 GGCCTCTGGGAGTCCAGAGCTGG + Intergenic
948398379 2:237664015-237664037 GGGCACTGGGAGGGAGGAGCAGG + Intronic
1169404712 20:5314061-5314083 GGCCACCAGGAAGTCGGAGATGG + Exonic
1170578614 20:17681962-17681984 GGCCGTCGGGGGGCCGGGGCCGG - Intronic
1171012790 20:21517609-21517631 GGACGCCGGGAGGCCTGCGCAGG + Intergenic
1172097339 20:32466894-32466916 GTCCACGGGGAGGCAGCAGCAGG + Intronic
1172100915 20:32483612-32483634 GGGCACGGGGAGGCGGGAGAGGG + Intronic
1172191736 20:33065868-33065890 GGCCTCTGGGAGGCTGGAACAGG + Intronic
1172517038 20:35542178-35542200 CGCCACCGGTAGGCCGCAGCGGG + Exonic
1172619617 20:36310351-36310373 GGCCACAGGGAGGCTGGTGGTGG + Intronic
1174283961 20:49459171-49459193 GGACACGGGGAGGCAGGAGATGG + Intronic
1175069826 20:56323997-56324019 GGCCAATGGGAGGCAGCAGCTGG + Intergenic
1175394643 20:58650258-58650280 GCCCAGCGCGCGGCCGGAGCGGG - Intergenic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176121684 20:63456923-63456945 AGCCAGCGTGAGGCCGGAGTGGG + Intronic
1176278780 20:64289037-64289059 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1176808453 21:13514918-13514940 GGTCACTGGGTGGCAGGAGCTGG + Intergenic
1177548052 21:22584501-22584523 GCCCTTCGGGAGGCCGGGGCGGG - Intergenic
1177647877 21:23922591-23922613 GCCCACTGGGAGGCCGAGGCAGG + Intergenic
1178623373 21:34195693-34195715 GGCCACTGGGACTCCAGAGCAGG - Intergenic
1178632621 21:34275872-34275894 GGCCATCGAGTGGCCGAAGCAGG + Intergenic
1178680580 21:34669787-34669809 GGCCCCCGAGAGGCAGGAGGAGG + Exonic
1178931344 21:36821213-36821235 GGCCACAGTGAGGGCTGAGCTGG + Intronic
1179054135 21:37916091-37916113 GGACGCCGGGAAGCCGGACCTGG - Exonic
1179455087 21:41493827-41493849 GTCCTGCGGGTGGCCGGAGCAGG - Intronic
1179780387 21:43696428-43696450 GGGCACAGGGAGGCTGCAGCTGG + Intergenic
1179792367 21:43762916-43762938 GGGCACGGGGCGGCCGGGGCAGG + Intergenic
1179917293 21:44485683-44485705 GGCCACCGAGCGGCAGGACCAGG + Intergenic
1180141509 21:45896109-45896131 GCCACCCGGGAGGCCGGAGTGGG + Intronic
1180258383 21:46649756-46649778 GGGCAGCTGGGGGCCGGAGCTGG + Intronic
1180483873 22:15777640-15777662 GAGCACCGGGTGGCGGGAGCTGG + Intergenic
1180655695 22:17418932-17418954 AGCCAGCGAGAGGCTGGAGCTGG + Intronic
1180843771 22:18970830-18970852 CGGCCCCGGGAGGGCGGAGCCGG + Intergenic
1181057702 22:20267876-20267898 CGGCCCCGGGAGGGCGGAGCCGG - Intronic
1181316615 22:21974723-21974745 GGCTGCCGGGAGCCAGGAGCAGG + Intronic
1182260966 22:29073007-29073029 GGCGGCCGGGCGGCCGGGGCGGG + Intergenic
1182696517 22:32202599-32202621 GGCCACTGGGTGGCAGGGGCCGG + Intronic
1182718506 22:32378626-32378648 GGCCTCCAGGAGGCTGGGGCTGG + Intronic
1183247930 22:36708290-36708312 GGCAACTGTGAGGCAGGAGCAGG + Intergenic
1183509679 22:38227461-38227483 AGCCACCGGGAAGCCGGCGCAGG + Intronic
1184186936 22:42871321-42871343 GGCCAGCGGGGGGACGGAGGCGG - Exonic
1185101051 22:48841016-48841038 GACCACGGGGAGGCCAGGGCAGG - Intronic
1185134725 22:49063136-49063158 AGGCACCAGGAGGCCAGAGCAGG + Intergenic
950811232 3:15651642-15651664 AGCCAGTGGGAGGCCGCAGCAGG - Intergenic
951613919 3:24521723-24521745 GGTCGCCGGGAGCCCGGAGCCGG + Intergenic
952377672 3:32780979-32781001 CGCCTCCGGGAGGCCGAGGCAGG - Intergenic
953326203 3:42014010-42014032 AGCCGCCGGGCGGCCGGGGCCGG + Intronic
954713179 3:52514842-52514864 GGCCACAGGAAGGCCGGCACGGG + Intronic
955085237 3:55696358-55696380 GGCCACAGGAAGGCCAGGGCTGG + Intronic
960023004 3:112976565-112976587 GGACACTGGGAGGCCGAGGCGGG + Intergenic
960962264 3:123080316-123080338 GGCTACCTGGAGGCTGGAGACGG + Intronic
961081556 3:124033030-124033052 GCTCCCCGGGAGGCCGGCGCGGG + Intergenic
961357513 3:126348456-126348478 GACCACCAGGTGGCCAGAGCAGG + Intronic
962367342 3:134795267-134795289 AGCCTACGGGAGGACGGAGCCGG - Exonic
962919109 3:139935305-139935327 AGGCACCGGGAGGCGAGAGCCGG + Exonic
962919894 3:139941208-139941230 GACCATGGGGAGGCCTGAGCTGG + Intronic
963804997 3:149714157-149714179 AGCCAGCGGGAGCCGGGAGCAGG + Intronic
966886271 3:184379735-184379757 GGCCACAGGGCGGCTGGACCAGG - Intronic
967054892 3:185823615-185823637 GGCCACCGGGAGGAGAGGGCAGG - Intronic
967974629 3:195026233-195026255 GGACACTGGGAGGCCGAGGCGGG + Intergenic
968077663 3:195825276-195825298 GGCGACCGCGAGGCCGAGGCAGG - Intergenic
968369620 3:198215057-198215079 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
968370020 3:198218471-198218493 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
968370073 3:198218757-198218779 GGCCACCAAGATGCAGGAGCTGG - Intergenic
968370105 3:198218918-198218940 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
968370185 3:198219211-198219233 GGCCACCGTGAGGCCTGACCTGG - Intergenic
968370250 3:198219474-198219496 GGCCACCAGGAGGCAGGAGGTGG - Intergenic
968370295 3:198219637-198219659 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
968370688 3:198221217-198221239 GGCCACCGTGAGGGAGGAACAGG + Intergenic
968370816 3:198221734-198221756 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
968370844 3:198221834-198221856 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
968370883 3:198221993-198222015 GGCCGTCGAGAGGACGGAGCTGG - Intergenic
968370956 3:198222333-198222355 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
968522620 4:1040867-1040889 AGCCAGCGGGAGGCCTGTGCCGG - Intergenic
968596883 4:1490316-1490338 GGGCTCCGGGAGGCGGGAGGCGG - Intergenic
969285741 4:6200756-6200778 GGCCAGCGGGCGGCCGGGGCAGG + Intergenic
969395889 4:6921024-6921046 GCACACTGGGAGGCCGAAGCAGG - Intronic
969413097 4:7042592-7042614 GCCCAGCCGGAGCCCGGAGCCGG - Exonic
969435909 4:7189308-7189330 GGCGACCCTGATGCCGGAGCTGG - Intergenic
972437188 4:39045179-39045201 GCGCTCCGGGAGGCCGCAGCGGG - Intronic
972602400 4:40584208-40584230 GCACATTGGGAGGCCGGAGCAGG - Intronic
973894165 4:55395882-55395904 GGCCAATGGGAGGCCGTCGCGGG + Intergenic
974036748 4:56824191-56824213 GGACACCGGAAGGCAGGAGGAGG - Intergenic
974055109 4:56976746-56976768 GGCCAGCAGGAGCCCGGCGCGGG + Exonic
974607586 4:64173554-64173576 AGCCAGCGGGAGGCAGGAACAGG + Intergenic
975529512 4:75386071-75386093 GGCCCCAGGGAGGCTGGAGAGGG - Intergenic
978888614 4:113796157-113796179 GGACATCGGGAGGCCGAGGCGGG - Intergenic
979258771 4:118630722-118630744 GGCCACCAAGATGCAGGAGCTGG - Intergenic
979258805 4:118630883-118630905 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
979258838 4:118631047-118631069 GGTCACCGTGAGGCATGAGCTGG - Intergenic
979258855 4:118631142-118631164 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
979258987 4:118631817-118631839 GGCCACTGCAAGGCAGGAGCTGG - Intergenic
979259274 4:118633368-118633390 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
979259318 4:118633557-118633579 GGCCGCCGGGAGGCAGGAGCTGG - Intergenic
979259336 4:118633620-118633642 GGCCGCCAAGAGGCCGGAGCTGG - Intergenic
979259362 4:118633723-118633745 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
979259411 4:118633932-118633954 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
979259493 4:118634225-118634247 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
979259521 4:118634323-118634345 GGCCGCCAGGAGGCCCAAGCTGG - Intergenic
979259537 4:118634386-118634408 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
979259564 4:118634481-118634503 GGCCGCCAAGAGGCCGGAGCTGG - Intergenic
979259641 4:118634821-118634843 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
979328731 4:119405803-119405825 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
979328809 4:119406143-119406165 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
979328835 4:119406239-119406261 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
979328863 4:119406338-119406360 GGCCACCGTGAGGCCTGACCTGG + Intergenic
979328942 4:119406631-119406653 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
979328989 4:119406840-119406862 GGCCGCTGGGAGGCATGAGCTGG + Intergenic
979329014 4:119406943-119406965 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
979329032 4:119407006-119407028 GGCCACCGGGAGGCAGGAGCTGG + Intergenic
979329246 4:119408080-119408102 GGCAACTGTGAGGCAGGAGCTGG + Intergenic
979329366 4:119408744-119408766 GGCCACTGCAAGGCAGGAGCTGG + Intergenic
979329495 4:119409415-119409437 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
979329544 4:119409674-119409696 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
979329578 4:119409834-119409856 GGCCACCAAGATGCAGGAGCTGG + Intergenic
979329630 4:119410120-119410142 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
982291744 4:153788988-153789010 GGACACCGGGAGGACAGCGCGGG + Exonic
984947116 4:184978330-184978352 GACCTCGGGGAGGGCGGAGCTGG - Intergenic
984973441 4:185209975-185209997 GGGCCCCGGGCGGCCGGAGCTGG + Intronic
986815731 5:11407981-11408003 GGCCAATGGGAGGCAGGAGAAGG + Intronic
987275257 5:16355475-16355497 GGACTCTGGGAGGCCGAAGCGGG - Intergenic
995224565 5:109689270-109689292 GGACACTGGGAGGCAGGCGCGGG + Intergenic
996298605 5:121954362-121954384 GGGCTGCCGGAGGCCGGAGCAGG - Intergenic
997303977 5:132825376-132825398 GGGCCCAGGGAGGCCAGAGCTGG + Exonic
997583722 5:135032975-135032997 GGCCCGCGGGTGGCCGGCGCGGG - Intronic
997865852 5:137462148-137462170 GGCCACCAGGAGGCCACATCTGG + Intronic
997960212 5:138315167-138315189 GCACACTGGGAGGCCGAAGCGGG - Intronic
998151369 5:139759362-139759384 GGGCAGCAGGAGGCAGGAGCAGG - Intergenic
998444339 5:142187024-142187046 CACCACCGGGAGGGCGGTGCGGG - Intergenic
1001309095 5:170598028-170598050 AGTCACCGGGAGGCAGGAGTGGG - Intronic
1001392183 5:171388114-171388136 GACCGACGGGAGGCCTGAGCGGG + Intronic
1002196301 5:177503488-177503510 GGAGACCCGGAGGCCCGAGCTGG - Intronic
1002306358 5:178286213-178286235 AGTCACTGGGAGGCCTGAGCAGG - Intronic
1002460777 5:179372532-179372554 GGTCTCCGGGAGTCTGGAGCTGG - Intergenic
1002521789 5:179796401-179796423 GGCCCCCGGGCCGACGGAGCCGG + Exonic
1002567321 5:180119284-180119306 GTCCCCCGAGAGGCCGGAGTGGG - Intronic
1002619361 5:180476180-180476202 GGACTCTGGGAGGCCAGAGCGGG - Intergenic
1002728900 5:181320642-181320664 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1002729299 5:181324049-181324071 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1002729352 5:181324335-181324357 GGCCACCAAGATGCAGGAGCTGG - Intergenic
1002729384 5:181324496-181324518 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1002729419 5:181324660-181324682 GGCCACCGTGAGGCATAAGCTGG - Intergenic
1002729438 5:181324755-181324777 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1002729583 5:181325467-181325489 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1002729630 5:181325676-181325698 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1002729711 5:181325969-181325991 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1002729777 5:181326232-181326254 GGCCACCAGGAGGCAGGAGGTGG - Intergenic
1002729828 5:181326398-181326420 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1002729921 5:181326772-181326794 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1002730050 5:181327290-181327312 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1002730078 5:181327390-181327412 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1002730117 5:181327549-181327571 GGCCGTCGAGAGGACGGAGCTGG - Intergenic
1002730193 5:181327889-181327911 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1002754339 6:146210-146232 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1002897539 6:1388379-1388401 GGAGAGCAGGAGGCCGGAGCTGG - Intergenic
1004140572 6:13013862-13013884 GGCCCCCGGGCGCCCGGGGCCGG - Intronic
1006437032 6:34031058-34031080 GGCCACCAGGAGGTGGTAGCAGG + Intronic
1006794286 6:36722015-36722037 GCCCACAGAGAGGCTGGAGCAGG + Exonic
1007114881 6:39336339-39336361 GGCCACCGAGAGGCTGGGGCTGG - Exonic
1007183007 6:39944119-39944141 AGCCACCGGGAGGCTGAGGCAGG - Intergenic
1007390452 6:41547171-41547193 GGGCAGCCGGAGGCCGGGGCGGG + Intronic
1007691863 6:43707639-43707661 GGCCACAGCGAGGCAGGGGCAGG + Intergenic
1008649021 6:53544797-53544819 CGCCGCCGGGGAGCCGGAGCGGG - Exonic
1012466360 6:99521000-99521022 GGGCGCCAGGAGGCCGGAGCAGG + Intronic
1013029879 6:106323029-106323051 AGCCACTGGGAGGCTGAAGCAGG - Intronic
1015969289 6:138728280-138728302 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1016773140 6:147874527-147874549 GGCCAGCTGGTGGCAGGAGCTGG + Intergenic
1017005498 6:150025720-150025742 GGCCACCAAGCTGCCGGAGCGGG - Intergenic
1019533216 7:1513959-1513981 GGGGAGCGGGAGGCGGGAGCAGG + Intergenic
1019554186 7:1620383-1620405 AGCCACCGGGAGGCCGAGGCAGG - Intergenic
1019663901 7:2241929-2241951 GGCCGTGGGGAGGCCGGGGCCGG - Intronic
1020046795 7:5046344-5046366 GGCTCCCGAGAGGCCGGGGCGGG - Exonic
1020070400 7:5223483-5223505 GGACACGAGGAGGCAGGAGCTGG - Intronic
1020085658 7:5308911-5308933 GGCCGCCGGGAGGCTGCGGCTGG + Exonic
1021411095 7:20330816-20330838 GCCCCCCGGGGGGCCAGAGCAGG + Intronic
1022089101 7:27096307-27096329 GGCCTCCGGGAGGTGGGGGCTGG + Intergenic
1023400693 7:39791740-39791762 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1023400761 7:39792088-39792110 GGGCGCCGGGAGGCAGGAGCTGG - Intergenic
1023400781 7:39792151-39792173 GGCCGCCGAGAGGCTGGAGCTGG - Intergenic
1023400937 7:39792753-39792775 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1023400964 7:39792852-39792874 GGTCGCCGGGAGGCCCAAGCTGG - Intergenic
1023401002 7:39793016-39793038 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1023401020 7:39793080-39793102 GGCCCCTGGGAGGCAAGAGCGGG - Intergenic
1023401054 7:39793182-39793204 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1023401086 7:39793314-39793336 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1023401132 7:39793479-39793501 GGCCACTGGGAGGCAGGATGTGG + Intergenic
1023401221 7:39793849-39793871 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1023401248 7:39793948-39793970 GGCTGCCGGGAGGCCCAAGCTGG - Intergenic
1023401264 7:39794011-39794033 GGCCGCCGGGAGGCTGGAGCTGG - Intergenic
1023401290 7:39794107-39794129 GGCCGCCGAGAGGACGGAGCTGG - Intergenic
1023401366 7:39794439-39794461 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1023781300 7:43658245-43658267 GGGCACCGGGAGGCGGAGGCAGG + Intronic
1024073708 7:45807933-45807955 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1024073744 7:45808097-45808119 GGCCACCGTGAGGCAAGAGCTGG - Intergenic
1024073764 7:45808192-45808214 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1024073936 7:45809116-45809138 GGCTGCCGGGAGGCCGAAGGTGG - Intergenic
1024074123 7:45810160-45810182 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1024074182 7:45810414-45810436 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
1024074226 7:45810603-45810625 GGGCACCGGGAGGCAGGAGCTGG - Intergenic
1024074247 7:45810666-45810688 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1024074272 7:45810769-45810791 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1024074310 7:45810929-45810951 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1024074388 7:45811222-45811244 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024074414 7:45811321-45811343 GGTCACCGGGAGGCCCAAGCTGG - Intergenic
1024074448 7:45811485-45811507 GGCCACCGAGAGGCAGTAGGCGG - Intergenic
1024074496 7:45811651-45811673 GGCCACCGTGAGGGAGGAACTGG - Intergenic
1024074596 7:45812057-45812079 GGCCACTGTGAGGGAGGAGCAGG + Intergenic
1024074635 7:45812210-45812232 GGCCACTGGGAGGCAGGATGTGG + Intergenic
1024074721 7:45812580-45812602 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024074747 7:45812679-45812701 GGTCACCGGGAGGCCCAAGCTGG - Intergenic
1024074781 7:45812843-45812865 GGCCACCGAGAGGCAGTAGGCGG - Intergenic
1024074826 7:45813009-45813031 GGCCACCGTGAGGGAGGAACTGG - Intergenic
1024075069 7:45813974-45813996 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1024075118 7:45814138-45814160 GGCCACTGGGAGGCAGGATGTGG + Intergenic
1024075210 7:45814494-45814516 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024075238 7:45814593-45814615 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1024075252 7:45814656-45814678 GGCTGCCGGGAGGCTGGAGCTGG - Intergenic
1024075350 7:45815083-45815105 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1024648323 7:51386574-51386596 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
1024648348 7:51386670-51386692 GGCCGCCGGGAGGCCAGAGCTGG + Intergenic
1024648365 7:51386733-51386755 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1024648394 7:51386832-51386854 GGCCACCGTGAGGCCGGAGCTGG + Intergenic
1024648481 7:51387202-51387224 GGCCACTGGGAGGCAGGATGTGG - Intergenic
1024648525 7:51387367-51387389 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1024648581 7:51387597-51387619 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1024648630 7:51387761-51387783 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1024648668 7:51387925-51387947 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1024648695 7:51388024-51388046 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1024648774 7:51388313-51388335 GGCCACTGGCCGGCAGGAGCTGG + Intergenic
1024648854 7:51388647-51388669 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
1024648881 7:51388743-51388765 GGCCACCGGGAGGCTGGAGCTGG + Intergenic
1024648897 7:51388806-51388828 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1024648926 7:51388905-51388927 GGCCACCGTGAGGCCGGAGCTGG + Intergenic
1024649009 7:51389198-51389220 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1024649062 7:51389429-51389451 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1024649074 7:51389466-51389488 GGCCACTGGGAGGCAGGAGGAGG + Intergenic
1024649087 7:51389532-51389554 GGCTGCCGAGAGGCCGGAGCTGG + Intergenic
1024649105 7:51389595-51389617 GGCCGCCGGGAGGCAAGAGCTGG + Intergenic
1024649148 7:51389784-51389806 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1024649209 7:51390038-51390060 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1024649395 7:51391082-51391104 GGCTGCCGGGAGGCCGAAGGTGG + Intergenic
1024649590 7:51392103-51392125 GGCCACCGTGAGGCATGAGCTGG + Intergenic
1024649625 7:51392267-51392289 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
1025052101 7:55740709-55740731 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1025052174 7:55741043-55741065 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
1025052200 7:55741139-55741161 GGCCGCCGGGAGGCTGGAGCTGG + Intergenic
1025052214 7:55741202-55741224 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025052242 7:55741301-55741323 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025052332 7:55741671-55741693 GGCCACTGGGAGGCAGGATGTGG - Intergenic
1025052374 7:55741835-55741857 GGCCACTGTGAGGGAGGAGCAGG - Intergenic
1025052527 7:55742420-55742442 GGCCACCGTGAGGGGGGAACTGG + Intergenic
1025052562 7:55742522-55742544 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025052578 7:55742586-55742608 GGCCACCGGGAGGCAGTAGGTGG + Intergenic
1025052640 7:55742849-55742871 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025052766 7:55743383-55743405 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025052912 7:55743877-55743899 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025052945 7:55743979-55744001 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025052958 7:55744043-55744065 GGCCACCGAGAGGCAGTAGGTGG + Intergenic
1025052997 7:55744207-55744229 GGTCACCGGGAGGCCCAAGCTGG + Intergenic
1025053024 7:55744306-55744328 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025053105 7:55744599-55744621 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025053140 7:55744759-55744781 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025053166 7:55744862-55744884 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025053187 7:55744925-55744947 GGGCGCCGGGAGGCTGGAGCTGG + Intergenic
1025053229 7:55745114-55745136 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025053289 7:55745368-55745390 GGCCACCGTGAGGGAGGAGCTGG + Intergenic
1025053651 7:55747338-55747360 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1025053671 7:55747433-55747455 GGCCACCGTGAGGCAAGAGCTGG + Intergenic
1025053707 7:55747597-55747619 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
1025129060 7:56366392-56366414 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1025129132 7:56366726-56366748 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
1025129155 7:56366822-56366844 GGCCGCCGGGAGGCTGGAGCTGG + Intergenic
1025129199 7:56366984-56367006 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025129286 7:56367354-56367376 GGCCACCGGGAGGCAGGATGTGG - Intergenic
1025129335 7:56367518-56367540 GGCCCCCGTGAGGGAGGAGCAGG - Intergenic
1025129850 7:56369529-56369551 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025129863 7:56369593-56369615 GGCCACCGAGAGGCAGTAGGTGG + Intergenic
1025129923 7:56369856-56369878 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130003 7:56370201-56370223 GGCCACTGGGAGGCAGGATGTGG - Intergenic
1025130049 7:56370369-56370391 GGCCACCGTGAGGGAGAAGCAGG - Intergenic
1025130123 7:56370681-56370703 GGCCACCGTGAGGGAGGAACTGG + Intergenic
1025130149 7:56370758-56370780 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025130163 7:56370822-56370844 GGCCACCGAGAGGCAGTAGGCGG + Intergenic
1025130222 7:56371085-56371107 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130311 7:56371455-56371477 GGCCACCGGGAGGCAGGATGTGG - Intergenic
1025130355 7:56371619-56371641 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025130469 7:56372056-56372078 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025130483 7:56372120-56372142 GGCCACCGAGAGGCAGTAGGCGG + Intergenic
1025130542 7:56372383-56372405 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130631 7:56372753-56372775 GGCCACCGGGAGGCAGGATGTGG - Intergenic
1025130675 7:56372917-56372939 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025130788 7:56373350-56373372 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025130802 7:56373414-56373436 GGCCACCGAGAGGCAGTAGGCGG + Intergenic
1025130860 7:56373677-56373699 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130947 7:56374047-56374069 GGCCACCGGGAGGCAGGATGTGG - Intergenic
1025130990 7:56374210-56374232 GGCCACCGTGAGGGAGGAGCAGG - Intergenic
1025131078 7:56374570-56374592 GGCCACCGTGAGGGAGGAACTGG + Intergenic
1025131104 7:56374647-56374669 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025131118 7:56374711-56374733 GGCCACCGAGAGGCAGTAGGCGG + Intergenic
1025131153 7:56374875-56374897 GGTCGCCGGGAGGCCCAAGCTGG + Intergenic
1025131179 7:56374972-56374994 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025131332 7:56375587-56375609 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025131393 7:56375841-56375863 GGCCACCGTGAGGGAGGAGTTGG + Intergenic
1025131754 7:56377812-56377834 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1025131774 7:56377907-56377929 GGCCACCGTGAGGCAAGAGCTGG + Intergenic
1025131810 7:56378071-56378093 GGCCACTGGGTGGCAGGAGCTGG + Intergenic
1025131895 7:56378518-56378540 GGCTGCCGGGAGGTAGGAGCTGG + Intergenic
1025175885 7:56802283-56802305 GGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025176048 7:56802999-56803021 GGCCGTGGGGAGGCCGGAGCTGG + Intergenic
1025176080 7:56803154-56803176 GGCCACAGTGAGGCCCGAGCTGG + Intergenic
1025176112 7:56803283-56803305 GGCCACCGACAGGCAGGAGCTGG + Intergenic
1025176186 7:56803606-56803628 GGCCACCGCGAGGCAGGAGGTGG + Intergenic
1025176273 7:56803990-56804012 GGCTACCGTGAGGCCTGAGCTGG - Intergenic
1025176302 7:56804089-56804111 GGCCGCTGGGAGGCCCAAGCTGG - Intergenic
1025176318 7:56804152-56804174 GGCCACCGGGAGGCCGGAGCTGG - Intergenic
1025176336 7:56804216-56804238 GGCCGATGGGAGGCAGGAGCTGG - Intergenic
1025176406 7:56804482-56804504 GGCCCCTGGGAGGCAAGAGCGGG - Intergenic
1025176417 7:56804514-56804536 GGCCACCGTGGGGCGAGAGCTGG - Intergenic
1025176440 7:56804583-56804605 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1025177447 7:56809281-56809303 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025177519 7:56809615-56809637 GGCCGCCGAGAGGACGGAGCTGG + Intergenic
1025177579 7:56809860-56809882 GGCTGCCGGGAGGCCGGAGCTGG + Intergenic
1025177595 7:56809923-56809945 GGCTGCCGGGAGGCCCAAGCTGG + Intergenic
1025177618 7:56810022-56810044 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1025177715 7:56810396-56810418 GGCCACTGGCAGGTGGGAGCTGG + Intergenic
1025177765 7:56810627-56810649 GGCCACCAGGAGGCATGAACTGG + Intergenic
1025177788 7:56810727-56810749 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025177861 7:56811032-56811054 GGCCTCCGTGAGGCAGGAGCTGG + Intergenic
1025177923 7:56811259-56811281 GGCCACCGGGAGGCATGAGCTGG + Intergenic
1025177943 7:56811362-56811384 GGCCGCCGAGAGGCCAGAGCTGG + Intergenic
1025178110 7:56812066-56812088 GGCCACCGTGACGGAGGAGCTGG + Intergenic
1025178129 7:56812135-56812157 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025178190 7:56812394-56812416 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178219 7:56812493-56812515 GGCCACCATGAGGCCCGAGCTGG + Intergenic
1025178300 7:56812786-56812808 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025178354 7:56813013-56813035 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025178376 7:56813116-56813138 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025178540 7:56813805-56813827 GGCCACCGTGACGGAGGAGCTGG + Intergenic
1025178559 7:56813874-56813896 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025178589 7:56813970-56813992 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025178624 7:56814136-56814158 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025178653 7:56814235-56814257 GGCCGCCGAGAGGCCTGAGGTGG + Intergenic
1025178731 7:56814528-56814550 GGCCACTGGCAGGTGGGAGCTGG + Intergenic
1025178785 7:56814755-56814777 GGCCGCTGGGAGGCATGAGCTGG + Intergenic
1025178806 7:56814858-56814880 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025178978 7:56815595-56815617 GGCCACCGTGACGGAGGAGCTGG + Intergenic
1025178997 7:56815664-56815686 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025179027 7:56815760-56815782 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179060 7:56815926-56815948 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179089 7:56816025-56816047 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1025179168 7:56816318-56816340 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025179222 7:56816545-56816567 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179244 7:56816648-56816670 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025179434 7:56817481-56817503 GGCCACCGTGACGGAGGAGCTGG + Intergenic
1025179453 7:56817550-56817572 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025179483 7:56817646-56817668 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179515 7:56817812-56817834 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179544 7:56817911-56817933 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025179625 7:56818204-56818226 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025179679 7:56818431-56818453 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025179702 7:56818534-56818556 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025179883 7:56819319-56819341 GGCCACCGTGACGGAGGAGCTGG + Intergenic
1025179902 7:56819388-56819410 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025179932 7:56819484-56819506 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025179965 7:56819650-56819672 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025179994 7:56819749-56819771 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025180075 7:56820042-56820064 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025180128 7:56820269-56820291 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180150 7:56820372-56820394 GGCCGCCGAGAGGCCGGAGCTGG + Intergenic
1025180358 7:56821301-56821323 GGCCACCGTGACGGAGGAGCTGG + Intergenic
1025180377 7:56821370-56821392 GGCCGCCGTGAGGCCAGAGCTGG + Intergenic
1025180407 7:56821466-56821488 GGCCACCGGGAGGCAGGAGGTGG + Intergenic
1025180439 7:56821632-56821654 GGCCGCCGGGAGGCCCAAGCTGG + Intergenic
1025180467 7:56821731-56821753 GGCCGCCGTGAGGCCTGAGCTGG + Intergenic
1025180546 7:56822024-56822046 GGCCACTGGCAGGCGGGAGCTGG + Intergenic
1025180599 7:56822251-56822273 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025180621 7:56822354-56822376 GGCCACCGAGAGGCCGGAGCTGG + Intergenic
1025180801 7:56823139-56823161 GGCCACCGTGACGGAGGAGCTGG + Exonic
1025180820 7:56823208-56823230 GGCCGCCGTGAGGCCAGAGCTGG + Exonic
1025180850 7:56823304-56823326 GGCCACCGGGAGGCAGGAGGTGG + Exonic
1025180884 7:56823481-56823503 GGCCGCCGGGAGGCCCAAGCTGG + Exonic
1025180913 7:56823580-56823602 GGCCACCGTGAGGCCTGAGCTGG + Intronic
1025180993 7:56823871-56823893 GGCCACTGGCAGGCGGGAGCTGG + Intronic
1025181045 7:56824098-56824120 GGTCGCCGGGAGGCATGAGCTGG + Intronic
1025181066 7:56824201-56824223 GGCCGCCGAGAGGCCGGAGCTGG + Intronic
1025181228 7:56824890-56824912 GGCCACCGTGACGGAGGAGCTGG + Intronic
1025181247 7:56824959-56824981 GGCCGCCGTGAGGCCAGAGCTGG + Intronic
1025181277 7:56825055-56825077 GGCCACCGGGAGGCAGGAGGTGG + Intronic
1025181312 7:56825221-56825243 GGCCGCCGGGAGGCCCAACCTGG + Intronic
1025181340 7:56825320-56825342 GGCCACCGTGAGGCCTGAGCTGG + Intronic
1025181420 7:56825613-56825635 GGCCACTGGCAGGCGGGAGCTGG + Intronic
1025181473 7:56825840-56825862 GGCCGCCGGGAGGCATGAGCTGG + Intronic
1025181495 7:56825943-56825965 GGCCGCCGAGAGGCCGGAGCTGG + Intronic
1025181676 7:56826728-56826750 GGCCACCGTGACGGAGGAGCTGG + Intronic
1025181695 7:56826797-56826819 GGCCGCCGTGAGGCCAGAGCTGG + Intronic
1025181723 7:56826893-56826915 GGCCACCGGGAGGCAGGAGGTGG + Intronic
1025181756 7:56827059-56827081 GGCCGCCGGGAGGCCCAAGCTGG + Intronic
1025181786 7:56827158-56827180 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1025181917 7:56827682-56827704 GGCAGCCGGGAGGCATGAGCTGG + Intergenic
1025181937 7:56827785-56827807 GGCCGCCAAGAGGCCAGAGCTGG + Intergenic
1025182012 7:56828073-56828095 GACCACTGGCAGGCGGGAGCTGG + Intergenic
1025182061 7:56828304-56828326 GGCCGCCGGGAGGCATGAGCTGG + Intergenic
1025182142 7:56828656-56828678 CGCCACTGGGAGGCAGGAGCTGG + Intergenic
1025182200 7:56828910-56828932 GACCACCGTGAGGGAGGAGCTGG + Intergenic
1025182550 7:56830891-56830913 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1025182570 7:56830986-56831008 GGCCACCGTGAGGCATGAGTTGG + Intergenic
1025182607 7:56831150-56831172 GGCTACTGGGTGGCAGGAGCTGG + Intergenic
1025182787 7:56832107-56832129 GGCCACCGTGAGGCGTGAGCTGG + Intergenic
1025182854 7:56832433-56832455 GGCCACCTGGGGGCAGCAGCTGG + Intergenic
1025182958 7:56832972-56832994 GGCTGCTGGGAGGCAGGAGCTGG + Intergenic
1025208652 7:57008253-57008275 GGCCGCCGGGAGGCTGCGGCTGG - Intergenic
1025663295 7:63568625-63568647 GGCCGCCGGGAGGCTGCGGCTGG + Intergenic
1025688969 7:63744002-63744024 GGCTGCTGGGAGGCAGGAGCTGG - Intergenic
1025689072 7:63744541-63744563 GGCCACCTGGGGGCAGCAGCTGG - Intergenic
1025689139 7:63744867-63744889 GGCCACCGTGAGGCATGAGCTGG - Intergenic
1025689320 7:63745824-63745846 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1025689356 7:63745988-63746010 GGCCACCGTGAGGCATGAGTTGG - Intergenic
1025689380 7:63746103-63746125 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1025689787 7:63748339-63748361 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
1025689866 7:63748691-63748713 GGCCGCCGGGAGGTATGAGCTGG - Intergenic
1025689915 7:63748922-63748944 GACCACTGGCAGGCGGGAGCTGG - Intergenic
1025689983 7:63749210-63749232 GGCCGCCAAGAGGCCAGAGCTGG - Intergenic
1025690131 7:63749837-63749859 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025690159 7:63749936-63749958 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690194 7:63750102-63750124 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025690418 7:63751037-63751059 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025690440 7:63751140-63751162 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025690496 7:63751367-63751389 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1025690578 7:63751660-63751682 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025690606 7:63751759-63751781 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025690641 7:63751925-63751947 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025690670 7:63752021-63752043 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025690866 7:63752860-63752882 GGCCGCCGAGAGGCCGGAGTTGG - Intergenic
1025690888 7:63752963-63752985 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025690944 7:63753190-63753212 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1025691027 7:63753483-63753505 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025691056 7:63753582-63753604 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691092 7:63753748-63753770 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691121 7:63753844-63753866 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025691140 7:63753913-63753935 GGCCACCGTGACGGAGGAGCTGG - Intergenic
1025691306 7:63754635-63754657 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025691328 7:63754738-63754760 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691383 7:63754966-63754988 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1025691462 7:63755259-63755281 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025691491 7:63755358-63755380 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025691526 7:63755524-63755546 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025691553 7:63755620-63755642 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025691745 7:63756459-63756481 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025691767 7:63756562-63756584 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025691820 7:63756789-63756811 GGCCACTGGCAGGTGGGAGCTGG - Intergenic
1025691902 7:63757082-63757104 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025691931 7:63757181-63757203 GGCCGCCGGGAGGCCCAAGCTGG - Exonic
1025691966 7:63757347-63757369 GGCCACCGGGAGGCAGGAGGTGG - Exonic
1025691995 7:63757443-63757465 GGCCGCCGTGAGGCGAGAGCTGG - Exonic
1025692014 7:63757512-63757534 GGCCACCGTGACGGAGGAGCTGG - Exonic
1025692192 7:63758282-63758304 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025692214 7:63758385-63758407 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692268 7:63758612-63758634 GGCCACTGGCAGGTGGGAGCTGG - Intergenic
1025692350 7:63758905-63758927 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025692379 7:63759004-63759026 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692415 7:63759170-63759192 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025692444 7:63759266-63759288 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025692463 7:63759335-63759357 GGCCACCGTGACGGAGGAGCTGG - Intergenic
1025692638 7:63760105-63760127 GGCCGTCGAGAGGCCGGAGCTGG - Intergenic
1025692660 7:63760208-63760230 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025692715 7:63760435-63760457 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1025692794 7:63760728-63760750 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025692823 7:63760827-63760849 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025692859 7:63760993-63761015 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025692888 7:63761089-63761111 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025692907 7:63761158-63761180 GGCCACCGTGACGGAGGAGCTGG - Intergenic
1025693054 7:63761784-63761806 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025693076 7:63761887-63761909 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693130 7:63762114-63762136 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1025693211 7:63762407-63762429 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025693240 7:63762506-63762528 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693275 7:63762672-63762694 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693304 7:63762768-63762790 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025693500 7:63763607-63763629 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025693522 7:63763710-63763732 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1025693575 7:63763937-63763959 GGCCACTGGCAGGTGGGAGCTGG - Intergenic
1025693654 7:63764230-63764252 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025693683 7:63764329-63764351 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025693718 7:63764495-63764517 GGCCACCGGGAGGCAGGAGGTGG - Intergenic
1025693747 7:63764591-63764613 GGCCGCCGTGAGGCGAGAGCTGG - Intergenic
1025693766 7:63764660-63764682 GGCCACCGTGACGGAGGAGCTGG - Intergenic
1025693963 7:63765509-63765531 GGCCGCCGAGAGGCCGGAGCTGG - Intergenic
1025693985 7:63765612-63765634 GGCCACCAGGAGGCATGAACTGG - Intergenic
1025694038 7:63765843-63765865 GGCCACTGGCAGGTGGGAGCTGG - Intergenic
1025694137 7:63766217-63766239 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1025694162 7:63766316-63766338 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1025694179 7:63766379-63766401 GGCCGCCGGGAGGCCGGAGCTGG - Intergenic
1025694219 7:63766542-63766564 GTCTGCCGGGAGGCTGGAGCTGG - Intergenic
1025694245 7:63766638-63766660 GGCCGCCGAGAGGACGGAGCTGG - Intergenic
1025694345 7:63767107-63767129 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1025695278 7:63771507-63771529 GGCCTCCGCGAGGCACGAGCTGG + Intergenic
1025695351 7:63771803-63771825 GGCCACTGTGAGGGAGGAGCTGG + Intergenic
1025695383 7:63771904-63771926 GGCCCCTGGGAGGCAAGAGCGGG + Intergenic
1025695474 7:63772270-63772292 GGCCACCGGGAAGCCGGAGCTGG + Intergenic
1025695490 7:63772333-63772355 GGCCGCTGGGAGGCCCAAGCTGG + Intergenic
1025695519 7:63772432-63772454 GGCTACCGTGAGGCCTGAGCTGG + Intergenic
1025695682 7:63773139-63773161 GGCCGCCGACAGGCAGGAGCTGG - Intergenic
1025695714 7:63773268-63773290 GGCCACAGTGAGGCCCGAGCTGG - Intergenic
1025695746 7:63773423-63773445 GGCCGTGGGGAGGCCGGAGCTGG - Intergenic
1025695908 7:63774139-63774161 GGCCACTGGGAGGCAGGAGCTGG - Intergenic
1025912280 7:65838695-65838717 GGCCACCTGGAGGCAGCAGCTGG - Intergenic
1025912385 7:65839208-65839230 AGCCACCGGGATGCGGGAGCTGG - Intergenic
1025912504 7:65839818-65839840 GGCCACCGTGAGGCATGAACTGG - Intergenic
1025912600 7:65840298-65840320 GGCCACTGTGAGGCATGAGCTGG - Intergenic
1025912697 7:65840782-65840804 GGCCAGTGTGAGGCAGGAGCTGG - Intergenic
1025912778 7:65841176-65841198 GGCCACCAGGAGGCAGGAGCTGG - Intergenic
1025912793 7:65841239-65841261 GGCCACCAAAAGGCAGGAGCTGG - Intergenic
1025912808 7:65841302-65841324 GGCCACCAAGAGGCATGAGCTGG - Intergenic
1025912924 7:65841911-65841933 GGCCACCATGAGGCAAGAGCTGG - Intergenic
1025912962 7:65842107-65842129 GGCCATTGTGAGGCAGGAGCTGG - Intergenic
1025976724 7:66376542-66376564 GGCCACCGCGAGGCATGAGCTGG + Intronic
1025976735 7:66376574-66376596 GGCCAGCGTGAGGCAGGAGCCGG + Intronic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1025976876 7:66377093-66377115 GGCCCCCGGCAGGCGGGAGCCGG + Intronic
1025976899 7:66377161-66377183 GGCCGACGTGAGGCCGCAGCTGG + Intronic
1025976910 7:66377193-66377215 GGCCGCTGGCAGGCAGGAGCCGG + Intronic
1026045165 7:66902030-66902052 GGCCAGTGTGAGGCGGGAGCTGG - Intergenic
1026045328 7:66902688-66902710 GGCCATCAGGAGGCAGGAGCTGG - Intergenic
1026045428 7:66903102-66903124 GGCCGCCGTGAGGCAAGAGCTGG - Intergenic
1026045587 7:66903752-66903774 GGCCAACGTGAGGCAAGAGCTGG - Intergenic
1026045605 7:66903820-66903842 TGCCATCGGGAGGCAGGAGCCGG - Intergenic
1026045726 7:66904275-66904297 GGCCCGCGTGAGGCAGGAGCCGG - Intergenic
1026045737 7:66904307-66904329 GGCCGCCGCGAGGCACGAGCTGG - Intergenic
1026045923 7:66905232-66905254 GGCCAACAGAAGGCAGGAGCTGG - Intergenic
1026045983 7:66905533-66905555 GGCGGCCTGGAGGCAGGAGCTGG - Intergenic
1026046046 7:66905851-66905873 GGCCACTAGGAGGCAGGAGCTGG - Intergenic
1026727345 7:72879833-72879855 GGCTCCCGAGAGGCCGGGGCGGG - Exonic
1026747212 7:73022775-73022797 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026750862 7:73050918-73050940 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026754511 7:73079028-73079050 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026758163 7:73107061-73107083 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1026906478 7:74065806-74065828 AGCCAGAGGGAGGCCTGAGCTGG - Intronic
1026957890 7:74389277-74389299 GGCCACAGGGAGGACCCAGCCGG - Intronic
1027033316 7:74907346-74907368 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1027089242 7:75286423-75286445 GCACACTGGGAGGCCGAAGCAGG - Intergenic
1027092885 7:75314351-75314373 GCACACTGGGAGGCCGAAGCAGG - Intergenic
1027096528 7:75342318-75342340 GCACACTGGGAGGCCGAAGCAGG - Intergenic
1027116511 7:75485894-75485916 GGCTCCCGAGAGGCCGGGGCGGG + Exonic
1027121803 7:75527595-75527617 GGCTCCCGAGAGGCCGGGGCGGG + Intergenic
1027202346 7:76072002-76072024 GGCCACCGTGAGGCTTGAGCTGG + Intergenic
1027202370 7:76072102-76072124 GGCCACCGTGAGGCAAGATCTGG + Intergenic
1027202448 7:76072421-76072443 GGTCATCGGGATGCAGGAGCCGG + Intergenic
1027202639 7:76073182-76073204 GGCCACCGTGAGGCGTCAGCTGG + Intergenic
1027202665 7:76073282-76073304 GGCCGCCGTGAGGCAAGAGCTGG + Intergenic
1027202778 7:76073698-76073720 GGCCGATGGGAGGCAGGAGCCGG + Intergenic
1027203053 7:76074760-76074782 GGCCATCGGGACACAGGAGCTGG + Intergenic
1027203076 7:76074859-76074881 GGCCCTCGGCAGGCAGGAGCTGG + Intergenic
1027322819 7:77025362-77025384 GCACACTGGGAGGCCGAAGCAGG + Intergenic
1029134497 7:98359515-98359537 GCACACTGGGAGGCCGAAGCGGG - Intronic
1029397636 7:100319292-100319314 GCACACTGGGAGGCCGAAGCAGG - Intronic
1029721026 7:102364359-102364381 GGCTCCCGAGAGGCCGGGGCGGG - Exonic
1032051021 7:128651185-128651207 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1032051075 7:128651471-128651493 GGCCACCAAGATGCAGGAGCTGG - Intergenic
1032051108 7:128651632-128651654 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1032051160 7:128651876-128651898 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1032051304 7:128652588-128652610 GGCCGCCGGGAGGCATGAGCTGG - Intergenic
1032051352 7:128652797-128652819 GGCCACTGGCAGGTGGGAGCTGG - Intergenic
1032051430 7:128653090-128653112 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1032051493 7:128653353-128653375 GGCCACCAGGAGGCAGGAGGTGG - Intergenic
1032051544 7:128653519-128653541 GGCCACCGTGAGAGAGGAGCTGG - Intergenic
1032051590 7:128653696-128653718 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1032051719 7:128654214-128654236 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1032051763 7:128654376-128654398 GGCCGCTGGGAGGCCGGAGCTGG - Intergenic
1032051790 7:128654472-128654494 GGCCGCCGAGAGGACGGAGCTGG - Intergenic
1032051866 7:128654812-128654834 GGCCACTGGCAGGCAGTAGCTGG - Intergenic
1035286405 7:157809997-157810019 GGGAACCGCCAGGCCGGAGCTGG + Intronic
1035567215 8:649679-649701 TGCCTCCAGGAGGCAGGAGCTGG + Intronic
1036646253 8:10612706-10612728 GCCCTCGGGGAGGCCGGTGCTGG + Exonic
1037030029 8:14093248-14093270 GGCCACCAGGAGGCCAGATAGGG - Intronic
1038150902 8:24941994-24942016 GGCCACCGGGAGGCGGGGCGGGG - Intergenic
1038672961 8:29597048-29597070 GGCAACCAGGAGGCCAGAGAAGG - Intergenic
1040325901 8:46341362-46341384 GGCCACAGTGAGGCCAGATCGGG + Intergenic
1040332965 8:46401638-46401660 GGCCACAGGCAGGCCTGTGCGGG - Intergenic
1041908471 8:63060469-63060491 GGACTCTGGGAGGCCGAAGCAGG + Exonic
1044991566 8:97800863-97800885 GGACTTCGGGAGGCCGGGGCAGG + Intronic
1045541943 8:103094885-103094907 GGGAATAGGGAGGCCGGAGCAGG + Intergenic
1047498861 8:125427465-125427487 GGCCCCTGGGTGGGCGGAGCTGG + Intergenic
1049122920 8:140756076-140756098 GCACACTGGGAGGCCGGGGCAGG + Intronic
1049258764 8:141627701-141627723 GGTCCCAGGGAGGCCGGAGCGGG - Intergenic
1049266636 8:141671186-141671208 GGCAAGTGGGAGGCTGGAGCAGG - Intergenic
1049279357 8:141736539-141736561 GGCCATGGTGACGCCGGAGCTGG - Intergenic
1049719964 8:144111235-144111257 GGCCTCCAGGAGGGCTGAGCAGG - Intronic
1049731376 8:144180314-144180336 GGCCACCGAGAGGCTGGCGAGGG - Exonic
1051171574 9:14322714-14322736 GGGACCCGGGAGGCGGGAGCGGG + Intronic
1055090973 9:72364761-72364783 GGCCTCCGGGAAGGCTGAGCCGG + Intronic
1057337315 9:94166220-94166242 GGTCGCCGGGAGGCCGATGCAGG - Intergenic
1057444928 9:95107095-95107117 GGCCTCCAGGAGCCCAGAGCAGG + Exonic
1057558832 9:96111423-96111445 AGCCACAGAGAGGCAGGAGCAGG + Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060583624 9:124772184-124772206 CGCCACCTGGTGGCCGCAGCGGG - Intergenic
1060812017 9:126615316-126615338 TGCGACCGGGACGCCGGGGCTGG + Intronic
1060895876 9:127216954-127216976 GACCACCTGGAGGGCGGTGCGGG + Intronic
1060926517 9:127459187-127459209 GGCCAAGGGGAGGGTGGAGCTGG - Intronic
1060994857 9:127870113-127870135 GGACACCTGGAGGCCACAGCAGG + Intronic
1061130838 9:128706836-128706858 AGACACAGGGAGGGCGGAGCAGG + Intronic
1061669010 9:132178140-132178162 GGCCACAGTGAGGCCTGAGGAGG + Intronic
1061931331 9:133834580-133834602 GGACACCCGGAGCCCGGAGTGGG - Intronic
1061987160 9:134136361-134136383 GTCCACCGAGGGGCCGGGGCGGG - Intronic
1062186332 9:135220550-135220572 GTCCACCTGGGGGGCGGAGCTGG + Intergenic
1062491709 9:136808082-136808104 GCCCCCCCGGAGGCCGGAGCCGG - Exonic
1062532165 9:137006789-137006811 GGCCCCAGGGAGGCAGGACCTGG - Intergenic
1062580752 9:137228289-137228311 AGCCACGGGGTGGCCGGAGAAGG - Exonic
1062753960 9:138277741-138277763 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1062754013 9:138278027-138278049 GGCCACCAAGATGCAGGAGCTGG - Intergenic
1062754045 9:138278188-138278210 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1062754125 9:138278481-138278503 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1062754189 9:138278744-138278766 GGCCACCAGGAGGCAGGAGGTGG - Intergenic
1062754240 9:138278910-138278932 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1062754336 9:138279286-138279308 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1062754465 9:138279804-138279826 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1062754493 9:138279904-138279926 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1062754532 9:138280063-138280085 GGCCGTCGAGAGGACGGAGCTGG - Intergenic
1062754605 9:138280403-138280425 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1203576479 Un_KI270745v1:12520-12542 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203576876 Un_KI270745v1:15929-15951 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203577278 Un_KI270745v1:19350-19372 GGCTGCCGGGAGGTAGGAGCTGG - Intergenic
1203577356 Un_KI270745v1:19765-19787 GGCCACTGGGTGGCAGGAGCTGG - Intergenic
1203577391 Un_KI270745v1:19929-19951 GGCCACCGTGAGGCATAAGCTGG - Intergenic
1203577409 Un_KI270745v1:20024-20046 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1203577553 Un_KI270745v1:20736-20758 GGCTGCCGGGAGGCATGAGCTGG - Intergenic
1203577600 Un_KI270745v1:20945-20967 GGCCACTGGCAGGCGGGAGCTGG - Intergenic
1203577683 Un_KI270745v1:21238-21260 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1203577749 Un_KI270745v1:21501-21523 GGCCACCAGGAGGCAGGAGGTGG - Intergenic
1203577800 Un_KI270745v1:21667-21689 GGCCACCGTGAGGGAGGAGCTGG - Intergenic
1203578240 Un_KI270745v1:23446-23468 GGCCACCGTGAGGGAGGAACAGG + Intergenic
1203578369 Un_KI270745v1:23964-23986 GGCCACCACGAGGCCTGAGCTGG - Intergenic
1203578397 Un_KI270745v1:24064-24086 GGCCGCCGGGAGGCCCAAGCTGG - Intergenic
1203578511 Un_KI270745v1:24563-24585 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1186506008 X:10092812-10092834 GGCCTCAGAGAGGCCGGGGCAGG - Intronic
1187181351 X:16946564-16946586 GGCAAGCGGGAGGCGGGGGCGGG + Intergenic
1194045979 X:89003920-89003942 GGACTTCGGGAGGCCAGAGCAGG + Intergenic
1196097700 X:111817436-111817458 AGCTACTGGGAGGCCGAAGCAGG - Intronic
1197694891 X:129540291-129540313 GGGCGCCGGGAGCCGGGAGCGGG - Exonic
1200207648 X:154328900-154328922 GGCCAAGGGGAGGCTGGGGCAGG - Intronic
1200223849 X:154405694-154405716 GGTCACTGGGAGGCTGGTGCTGG - Intronic
1200274139 X:154716025-154716047 GGCCACCTGGAGGATGGTGCAGG - Exonic
1202380874 Y:24276056-24276078 GGCCACCGTGAGGGAGGAGCAGG + Intergenic
1202381009 Y:24276591-24276613 GGCCACCGTGAGGCCTGAGCTGG - Intergenic
1202381034 Y:24276690-24276712 GGCTACCAGGAGGCCCAAGCTGG - Intergenic
1202381048 Y:24276753-24276775 GGCAGCCAGGAGGCTGGAGCTGG - Intergenic
1202381072 Y:24276849-24276871 GGCCACCGAGAGGACGGAGCTGG - Intergenic
1202381148 Y:24277183-24277205 GGCCACTGGCAGGCAGGAGCTGG - Intergenic
1202489637 Y:25392943-25392965 GGCCACTGGCAGGCAGGAGCTGG + Intergenic
1202489713 Y:25393277-25393299 GGCCACCGAGAGGACGGAGCTGG + Intergenic
1202489737 Y:25393373-25393395 GGCAGCCAGGAGGCTGGAGCTGG + Intergenic
1202489751 Y:25393436-25393458 GGCTACCAGGAGGCCCAAGCTGG + Intergenic
1202489776 Y:25393535-25393557 GGCCACCGTGAGGCCTGAGCTGG + Intergenic
1202489910 Y:25394069-25394091 GGCCACCGTGAGGGAGGAGCAGG - Intergenic