ID: 1025190997

View in Genome Browser
Species Human (GRCh38)
Location 7:56895771-56895793
Sequence TACCCAAGGATGCTCGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025190997_1025191002 3 Left 1025190997 7:56895771-56895793 CCTGCCACGAGCATCCTTGGGTA No data
Right 1025191002 7:56895797-56895819 CCAATAGCCCTAATTAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025190997 Original CRISPR TACCCAAGGATGCTCGTGGC AGG (reversed) Intergenic
No off target data available for this crispr