ID: 1025191146

View in Genome Browser
Species Human (GRCh38)
Location 7:56896943-56896965
Sequence GAGGTTGGTCACTTCTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025191142_1025191146 7 Left 1025191142 7:56896913-56896935 CCTGGAGTTCTGGGCAAGGGGAG No data
Right 1025191146 7:56896943-56896965 GAGGTTGGTCACTTCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025191146 Original CRISPR GAGGTTGGTCACTTCTTGCA TGG Intergenic
No off target data available for this crispr