ID: 1025192034

View in Genome Browser
Species Human (GRCh38)
Location 7:56903087-56903109
Sequence CTGGGGCCATGGATGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025192034_1025192043 25 Left 1025192034 7:56903087-56903109 CCTAGCACCATCCATGGCCCCAG No data
Right 1025192043 7:56903135-56903157 CCTTAAGTGTCTCCTAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025192034 Original CRISPR CTGGGGCCATGGATGGTGCT AGG (reversed) Intergenic
No off target data available for this crispr