ID: 1025192350

View in Genome Browser
Species Human (GRCh38)
Location 7:56905424-56905446
Sequence GTATAACTCCACAATGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025192350_1025192359 27 Left 1025192350 7:56905424-56905446 CCCTTCCCATTGTGGAGTTATAC No data
Right 1025192359 7:56905474-56905496 AGCATTGGAGACTTTCTGCCAGG No data
1025192350_1025192357 12 Left 1025192350 7:56905424-56905446 CCCTTCCCATTGTGGAGTTATAC No data
Right 1025192357 7:56905459-56905481 GAAAGCCACAGCATCAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025192350 Original CRISPR GTATAACTCCACAATGGGAA GGG (reversed) Intergenic
No off target data available for this crispr