ID: 1025194798

View in Genome Browser
Species Human (GRCh38)
Location 7:56924410-56924432
Sequence GAGGGGGCGCACGGGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025194798_1025194803 -10 Left 1025194798 7:56924410-56924432 CCACTGCACCCGTGCGCCCCCTC No data
Right 1025194803 7:56924423-56924445 GCGCCCCCTCCAATGCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025194798 Original CRISPR GAGGGGGCGCACGGGTGCAG TGG (reversed) Intergenic