ID: 1025199588

View in Genome Browser
Species Human (GRCh38)
Location 7:56953885-56953907
Sequence GTGGCAGACATTGGGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025199588_1025199595 9 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199595 7:56953917-56953939 AATGCATGGAAATTTGGAATTGG No data
1025199588_1025199597 20 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data
1025199588_1025199598 21 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199598 7:56953929-56953951 TTTGGAATTGGCAGGTAGATGGG No data
1025199588_1025199596 13 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199596 7:56953921-56953943 CATGGAAATTTGGAATTGGCAGG No data
1025199588_1025199594 3 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199594 7:56953911-56953933 CTTTGAAATGCATGGAAATTTGG No data
1025199588_1025199599 22 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199599 7:56953930-56953952 TTGGAATTGGCAGGTAGATGGGG No data
1025199588_1025199592 -5 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199592 7:56953903-56953925 GCCACTGACTTTGAAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025199588 Original CRISPR GTGGCAGACATTGGGGCACT TGG (reversed) Intergenic
No off target data available for this crispr