ID: 1025199593

View in Genome Browser
Species Human (GRCh38)
Location 7:56953904-56953926
Sequence TCCATGCATTTCAAAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025199593_1025199600 17 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199600 7:56953944-56953966 TAGATGGGGAGCTAGATAGATGG No data
1025199593_1025199597 1 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data
1025199593_1025199603 27 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199603 7:56953954-56953976 GCTAGATAGATGGATAGGTAGGG No data
1025199593_1025199598 2 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199598 7:56953929-56953951 TTTGGAATTGGCAGGTAGATGGG No data
1025199593_1025199599 3 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199599 7:56953930-56953952 TTGGAATTGGCAGGTAGATGGGG No data
1025199593_1025199595 -10 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199595 7:56953917-56953939 AATGCATGGAAATTTGGAATTGG No data
1025199593_1025199596 -6 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199596 7:56953921-56953943 CATGGAAATTTGGAATTGGCAGG No data
1025199593_1025199602 26 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199602 7:56953953-56953975 AGCTAGATAGATGGATAGGTAGG No data
1025199593_1025199601 22 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199601 7:56953949-56953971 GGGGAGCTAGATAGATGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025199593 Original CRISPR TCCATGCATTTCAAAGTCAG TGG (reversed) Intergenic
No off target data available for this crispr