ID: 1025199597

View in Genome Browser
Species Human (GRCh38)
Location 7:56953928-56953950
Sequence ATTTGGAATTGGCAGGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025199588_1025199597 20 Left 1025199588 7:56953885-56953907 CCAAGTGCCCCAATGTCTGCCAC No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data
1025199591_1025199597 11 Left 1025199591 7:56953894-56953916 CCAATGTCTGCCACTGACTTTGA No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data
1025199590_1025199597 12 Left 1025199590 7:56953893-56953915 CCCAATGTCTGCCACTGACTTTG No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data
1025199589_1025199597 13 Left 1025199589 7:56953892-56953914 CCCCAATGTCTGCCACTGACTTT No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data
1025199593_1025199597 1 Left 1025199593 7:56953904-56953926 CCACTGACTTTGAAATGCATGGA No data
Right 1025199597 7:56953928-56953950 ATTTGGAATTGGCAGGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025199597 Original CRISPR ATTTGGAATTGGCAGGTAGA TGG Intergenic
No off target data available for this crispr