ID: 1025200260

View in Genome Browser
Species Human (GRCh38)
Location 7:56957363-56957385
Sequence CTGTCAAAAGGGCTGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025200255_1025200260 2 Left 1025200255 7:56957338-56957360 CCTGATAAGTGTTGTTGAAAGAA No data
Right 1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG No data
1025200254_1025200260 12 Left 1025200254 7:56957328-56957350 CCGAGGAGGACCTGATAAGTGTT No data
Right 1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025200260 Original CRISPR CTGTCAAAAGGGCTGGGTGA AGG Intergenic
No off target data available for this crispr