ID: 1025200912

View in Genome Browser
Species Human (GRCh38)
Location 7:56961116-56961138
Sequence GGACGCATCCCCACCTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025200912_1025200920 1 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200920 7:56961140-56961162 AAGGTCGAGGCTCCTTGAGGGGG No data
1025200912_1025200923 28 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200923 7:56961167-56961189 TCCCAGCCCGCTAAGAGCACGGG No data
1025200912_1025200922 27 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200922 7:56961166-56961188 GTCCCAGCCCGCTAAGAGCACGG No data
1025200912_1025200916 -2 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200916 7:56961137-56961159 CCCAAGGTCGAGGCTCCTTGAGG No data
1025200912_1025200919 0 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200919 7:56961139-56961161 CAAGGTCGAGGCTCCTTGAGGGG No data
1025200912_1025200918 -1 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200918 7:56961138-56961160 CCAAGGTCGAGGCTCCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025200912 Original CRISPR GGACGCATCCCCACCTCATC AGG (reversed) Intergenic