ID: 1025200916

View in Genome Browser
Species Human (GRCh38)
Location 7:56961137-56961159
Sequence CCCAAGGTCGAGGCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025200912_1025200916 -2 Left 1025200912 7:56961116-56961138 CCTGATGAGGTGGGGATGCGTCC No data
Right 1025200916 7:56961137-56961159 CCCAAGGTCGAGGCTCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025200916 Original CRISPR CCCAAGGTCGAGGCTCCTTG AGG Intergenic