ID: 1025201929

View in Genome Browser
Species Human (GRCh38)
Location 7:56967710-56967732
Sequence GCGTGCACACAGATTCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025201927_1025201929 13 Left 1025201927 7:56967674-56967696 CCACAGACACACACAGACACATT No data
Right 1025201929 7:56967710-56967732 GCGTGCACACAGATTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025201929 Original CRISPR GCGTGCACACAGATTCAGAT AGG Intergenic
No off target data available for this crispr