ID: 1025206529

View in Genome Browser
Species Human (GRCh38)
Location 7:56996307-56996329
Sequence GGCAGGAGCCACAGTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025206522_1025206529 3 Left 1025206522 7:56996281-56996303 CCAGGGGCTGGGCACGGCTGCTC No data
Right 1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG No data
1025206521_1025206529 4 Left 1025206521 7:56996280-56996302 CCCAGGGGCTGGGCACGGCTGCT No data
Right 1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG No data
1025206520_1025206529 7 Left 1025206520 7:56996277-56996299 CCTCCCAGGGGCTGGGCACGGCT No data
Right 1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG No data
1025206519_1025206529 8 Left 1025206519 7:56996276-56996298 CCCTCCCAGGGGCTGGGCACGGC No data
Right 1025206529 7:56996307-56996329 GGCAGGAGCCACAGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025206529 Original CRISPR GGCAGGAGCCACAGTGGGAA GGG Intergenic
No off target data available for this crispr