ID: 1025208421

View in Genome Browser
Species Human (GRCh38)
Location 7:57007125-57007147
Sequence CCATCAACTCAGGCGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025208413_1025208421 22 Left 1025208413 7:57007080-57007102 CCATCTCTACAAAAATGAAAATA No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG No data
1025208410_1025208421 25 Left 1025208410 7:57007077-57007099 CCCCCATCTCTACAAAAATGAAA No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG No data
1025208411_1025208421 24 Left 1025208411 7:57007078-57007100 CCCCATCTCTACAAAAATGAAAA No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG No data
1025208412_1025208421 23 Left 1025208412 7:57007079-57007101 CCCATCTCTACAAAAATGAAAAT No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG No data
1025208414_1025208421 -5 Left 1025208414 7:57007107-57007129 CCGTGCATTCCTGTAGTCCCATC No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025208421 Original CRISPR CCATCAACTCAGGCGGCCGA GGG Intergenic