ID: 1025208421

View in Genome Browser
Species Human (GRCh38)
Location 7:57007125-57007147
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1527
Summary {0: 3, 1: 0, 2: 0, 3: 45, 4: 1479}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025208411_1025208421 24 Left 1025208411 7:57007078-57007100 CCCCATCTCTACAAAAATGAAAA 0: 47
1: 728
2: 6401
3: 28107
4: 152291
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG 0: 3
1: 0
2: 0
3: 45
4: 1479
1025208413_1025208421 22 Left 1025208413 7:57007080-57007102 CCATCTCTACAAAAATGAAAATA No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG 0: 3
1: 0
2: 0
3: 45
4: 1479
1025208410_1025208421 25 Left 1025208410 7:57007077-57007099 CCCCCATCTCTACAAAAATGAAA No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG 0: 3
1: 0
2: 0
3: 45
4: 1479
1025208414_1025208421 -5 Left 1025208414 7:57007107-57007129 CCGTGCATTCCTGTAGTCCCATC No data
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG 0: 3
1: 0
2: 0
3: 45
4: 1479
1025208412_1025208421 23 Left 1025208412 7:57007079-57007101 CCCATCTCTACAAAAATGAAAAT 0: 9
1: 282
2: 1644
3: 9318
4: 38225
Right 1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG 0: 3
1: 0
2: 0
3: 45
4: 1479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025208421 Original CRISPR CCATCAACTCAGGCGGCCGA GGG Intergenic
900086335 1:899546-899568 ACATCAGCTCAGGTGTCCGAGGG + Intergenic
900614498 1:3558910-3558932 CCAGCTACTCAGGAGGCTGAGGG + Intronic
900687918 1:3960566-3960588 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
901141115 1:7032078-7032100 CCAGCTACTCAGGAGGCTGAGGG - Intronic
901275951 1:7990996-7991018 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
901299277 1:8187478-8187500 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
901432898 1:9228501-9228523 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
901450841 1:9336339-9336361 CCAGCTACTCAGGAGGCTGAGGG - Intronic
901554468 1:10020686-10020708 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
901703339 1:11056991-11057013 CCAGCTACTCAGGAGGCTGATGG - Intronic
902317774 1:15636241-15636263 CCAGCTACTCAGGAGGCTGATGG - Intronic
902904795 1:19548278-19548300 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
903078508 1:20789873-20789895 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
903092442 1:20933538-20933560 CCAGCTACTCAGGGGGCTGAGGG + Intronic
903160766 1:21487652-21487674 CCAGCAACTCAGAAGGCTGAGGG - Intergenic
903481955 1:23660328-23660350 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
903556675 1:24198990-24199012 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
903616946 1:24666648-24666670 CCAACTACTCAGGAGGCTGAGGG + Intronic
903903141 1:26663486-26663508 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
904182889 1:28679290-28679312 CCATCTACTCAGGAGGCTGAGGG - Intronic
904217570 1:28934998-28935020 CCAGCTACTCAGGAGGCTGAGGG + Intronic
904276274 1:29386660-29386682 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
904502520 1:30923832-30923854 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
904533413 1:31183561-31183583 CCAGCTACTCAGGAGGCTGAGGG - Intronic
904634971 1:31872914-31872936 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
904775549 1:32903881-32903903 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
904781483 1:32952625-32952647 CCAGCTACTCAGGAGGCTGAGGG + Intronic
904799850 1:33084710-33084732 CCATCTACTCGGGAGGCTGAGGG - Intronic
905004987 1:34702537-34702559 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
905051277 1:35053216-35053238 CCATCTACTCAGGAGGTAGAGGG - Intergenic
905230033 1:36509450-36509472 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
905751465 1:40468194-40468216 CCAGCTACTCAGGAGGCCGAGGG + Intergenic
905795542 1:40814166-40814188 CCAGCTACTCAGGAGGCTGAGGG - Intronic
906336933 1:44940999-44941021 CCAGCTACTCAGGAGGCTGAGGG - Intronic
906378005 1:45312242-45312264 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
906398363 1:45486556-45486578 CCAGCTACTCAGGAGGCTGAGGG + Intronic
906503671 1:46361030-46361052 CCAGCTACTCAGGGGGCTGAGGG + Intronic
906991011 1:50738326-50738348 CCAGCTACTCAGGAGGCTGAGGG + Intronic
907175837 1:52521548-52521570 CCAGCTACTCAGGAGGCTGAAGG + Intronic
907330158 1:53665532-53665554 CCAGCTACTCAGGAGGCTGAGGG + Intronic
907354595 1:53861897-53861919 CCAGCTACTCAGGAGGCTGAGGG + Intronic
907416849 1:54320430-54320452 CCATCTACTCGGGAGGCTGAGGG - Intronic
907635887 1:56134486-56134508 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
908120537 1:60982136-60982158 CCAGCTACTCAGGAGGCTGAGGG - Intronic
908756157 1:67470585-67470607 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
908819543 1:68069983-68070005 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
909064019 1:70910963-70910985 CCAGCTACTCAGGAGGCTGAGGG + Intronic
909141665 1:71874957-71874979 CCAGCTACTCAGGAGGCTGAGGG - Intronic
909331174 1:74412727-74412749 CCAGCTACTCAGGAGGCTGAGGG - Intronic
909926300 1:81441650-81441672 CCAGCAACTCGGGAGGCTGAGGG - Intronic
910212327 1:84806428-84806450 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
910531554 1:88241854-88241876 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
910568972 1:88679167-88679189 CCAGCAACTCAGGAGGCTAAGGG - Intergenic
910823892 1:91384856-91384878 CCAGCTACTCAGGGGGCTGAGGG - Intronic
910828411 1:91433984-91434006 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
912369914 1:109165857-109165879 CCAGCTACTCAGGAGGCTGAGGG - Intronic
912392740 1:109315870-109315892 CCAGCTACTCAGGAGGCTGAAGG - Intronic
912423853 1:109568429-109568451 CCAGCTACTCAGGAGGCTGAGGG + Intronic
912455796 1:109796257-109796279 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
912660312 1:111522629-111522651 CCAGCTACTCAGGAGGCTGAGGG - Intronic
913242349 1:116840035-116840057 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
913682052 1:121195293-121195315 CCAGCTACTCAGGAGGCTGAGGG + Intronic
914033889 1:143982917-143982939 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
914155558 1:145085055-145085077 CCAGCTACTCAGGAGGCTGAGGG - Intronic
914693940 1:150058392-150058414 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
914752184 1:150542284-150542306 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
915130960 1:153695136-153695158 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
915185560 1:154102034-154102056 CCAGCTACTCAGGAGGCTGAGGG + Intronic
915566075 1:156713596-156713618 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
915719370 1:157973072-157973094 CCAACTACTCAGGAGGCTGAGGG - Intergenic
915725773 1:158016187-158016209 CCAGCTACTCAGGAGGCCGAGGG + Intronic
915728280 1:158034156-158034178 CCAGCTACTCAGGAGGCTGAGGG + Intronic
915907698 1:159890871-159890893 CCAGCTACTCAGGAGGCTGAGGG - Intronic
915966615 1:160314514-160314536 CCAGCTACTCAGGAGGCTGAGGG + Intronic
915968324 1:160331831-160331853 CCAGCTACTCAGGAGGCTGAGGG + Intronic
916041341 1:160964149-160964171 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
916118546 1:161508470-161508492 CCAGCTACTCAGGAGGCTGAGGG + Intronic
916568584 1:166005485-166005507 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
916797982 1:168185653-168185675 CCAGCTACTCAGGAGGCTGAGGG + Intronic
916928299 1:169547041-169547063 CCAGCTACTCGGGAGGCCGAGGG + Intronic
917330540 1:173875767-173875789 CCAGCTACTCAGGAGGCTGAGGG - Intronic
917514564 1:175696762-175696784 CCAGCTACTCAGGAGGCTGAGGG + Intronic
917747477 1:178024656-178024678 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
917851137 1:179065263-179065285 CCAGCTACTCAGGAGGCTGAGGG - Intronic
917972140 1:180215412-180215434 CCAGCTACTCAGGGGGCTGAGGG + Intergenic
918025589 1:180741599-180741621 CCAGCTACTCAGGAGGCTGAGGG - Intronic
918497891 1:185159837-185159859 CCAGCTACTCAGGAGGCTGAGGG - Intronic
918747955 1:188230609-188230631 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
918780740 1:188697070-188697092 CCACCTACTCAGGAGGCTGAGGG + Intergenic
919104156 1:193128406-193128428 CCAGCTACTCAGGAGGCTGAAGG - Intronic
919111170 1:193220276-193220298 CCAGCTACTCAGGAGGCTGAAGG - Intronic
919251269 1:195059381-195059403 CCAGCTACTCGGGCGGCTGAGGG + Intergenic
919461164 1:197879418-197879440 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
919561305 1:199123309-199123331 CCAGCTACTCAGGAGGCTGATGG + Intergenic
919618690 1:199839656-199839678 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
919706076 1:200677229-200677251 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
919898874 1:202028813-202028835 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
919961704 1:202476566-202476588 CCAGCAACTCGGGAGGCTGAGGG + Intronic
920393603 1:205627392-205627414 CCAGCTACTCAGGAGGCTGAGGG + Intronic
920469367 1:206213802-206213824 CCAGCTACTCAGGAGGCTGAGGG + Intronic
920667628 1:207975528-207975550 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
921058883 1:211565704-211565726 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
921357717 1:214302222-214302244 CCAGCTACTCAGGAGGCTGAGGG + Intronic
921429696 1:215051188-215051210 CCAGCTACTCAGGAGGCTGAAGG - Intronic
921442476 1:215203921-215203943 CCAGCTACTCGGGAGGCCGAGGG + Intronic
921595743 1:217051875-217051897 CCAACTACTCAGGAGGCTGAGGG - Intronic
921808917 1:219489244-219489266 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
921913522 1:220578955-220578977 CCAGCTACTCAGGAGGCTGAGGG - Intronic
922298620 1:224274520-224274542 CCAGCTACTCAGGAGGCTGAGGG + Intronic
922361186 1:224823006-224823028 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
922436370 1:225611431-225611453 CCAGCTACTCAGGAGGCTGAGGG - Intronic
922635640 1:227168038-227168060 CCAGCTACTCAGGAGGCTGAGGG - Intronic
922905653 1:229171707-229171729 CCAGCTACTCAGGAGGCCGAGGG + Intergenic
923021113 1:230164646-230164668 CCAGCTACTCAGGAGGCTGAGGG - Intronic
923151257 1:231235380-231235402 CCAGCTACTCAGGAGGCTGAGGG + Intronic
923170471 1:231411882-231411904 CCAGCTACTCAGGAGGCTGAGGG + Intronic
923594856 1:235353204-235353226 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
923673085 1:236057613-236057635 CCAGCTACTCAGGAGGCTGAGGG + Intronic
923721890 1:236473881-236473903 CCAGCTACTCAGGAGGCTGAAGG - Intronic
924117134 1:240759210-240759232 CCACCTACTCGGGAGGCCGAGGG + Intergenic
924438924 1:244070734-244070756 CCATCTACTCGGGAGGCTGAGGG - Intergenic
924476252 1:244384316-244384338 CCAGCTACTCAGGGGGCTGAGGG - Intronic
924500272 1:244631208-244631230 CCAGCTACTCAGGAGGCTGATGG + Intronic
924543114 1:244999931-244999953 CCAGCTACTCAGGAGGCTGAGGG - Intronic
924702348 1:246466731-246466753 CCAGCTACTCAGGAGGCTGATGG + Intronic
924939646 1:248804203-248804225 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1063431127 10:5989055-5989077 CCAGCTACTCAGGAGGCCGAGGG + Intergenic
1063543488 10:6957701-6957723 CCAGCAACTCAGGAGGCTGGAGG + Intergenic
1063582143 10:7317524-7317546 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1063669114 10:8085600-8085622 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1063675550 10:8138309-8138331 CCACCTACTCAGGAGGCTGAGGG - Intergenic
1063713848 10:8507779-8507801 CCAGCGACTCAGGAGGCTGAGGG - Intergenic
1063799381 10:9555743-9555765 CCAGCCACTCAGGAGGCTGAGGG - Intergenic
1064130500 10:12705344-12705366 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1064183427 10:13139533-13139555 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1064249664 10:13697269-13697291 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1064296560 10:14084259-14084281 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1064327946 10:14368075-14368097 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1064480954 10:15740198-15740220 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1064520753 10:16198333-16198355 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1064604896 10:17028604-17028626 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1064715721 10:18174516-18174538 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1065034342 10:21622270-21622292 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1065555683 10:26913494-26913516 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1065595790 10:27309780-27309802 CCAGCACCTCAGGAGGCCGAGGG + Intergenic
1065601551 10:27373917-27373939 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1065831530 10:29618833-29618855 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1065849628 10:29776942-29776964 CCAGCTACTCAGGAGGCCAAGGG - Intergenic
1065904547 10:30238670-30238692 CCAGCTACTCAGGAGGCCAAGGG - Intergenic
1065945767 10:30604577-30604599 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1066106283 10:32160218-32160240 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1066141351 10:32506600-32506622 CCAGCACCTCGGGAGGCCGAGGG + Intronic
1066251143 10:33633998-33634020 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1066268256 10:33797247-33797269 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1066348816 10:34617138-34617160 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1066515259 10:36152041-36152063 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1066651694 10:37662019-37662041 CCATCTACTTAGGAGGCTGAGGG + Intergenic
1066696046 10:38078461-38078483 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1066705338 10:38171587-38171609 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1066958421 10:42195563-42195585 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1068039708 10:51808486-51808508 CCAGCTACTCAGGAGGCTGACGG + Intronic
1068492881 10:57746317-57746339 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1069013488 10:63400971-63400993 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1069029621 10:63581626-63581648 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1069345785 10:67468277-67468299 CCAGCTACTCAGGAGGCTGACGG + Intronic
1069432397 10:68349403-68349425 CCAGCAACTCAGGAGGCTGAGGG + Intronic
1069464449 10:68625967-68625989 CCATCTACTCAGAAGGCTGAGGG + Intronic
1069509765 10:69033237-69033259 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1069655773 10:70087074-70087096 CCAGCTACTGAGGCGGCTGATGG + Intronic
1069666144 10:70161211-70161233 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1069905497 10:71729947-71729969 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1069933245 10:71897710-71897732 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1069964174 10:72100338-72100360 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1070261906 10:74864654-74864676 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1070373607 10:75808622-75808644 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1072160314 10:92760182-92760204 CCAGCTACTCAGGCGGTTGAGGG + Intergenic
1072359319 10:94643851-94643873 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1072704401 10:97670019-97670041 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1073079833 10:100852531-100852553 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1073132919 10:101201935-101201957 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1073168266 10:101477762-101477784 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1073298949 10:102459107-102459129 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1073333433 10:102686577-102686599 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1073347906 10:102798537-102798559 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1073364627 10:102928465-102928487 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1073671309 10:105593488-105593510 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1073938230 10:108660948-108660970 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1073984972 10:109197778-109197800 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1074195933 10:111185289-111185311 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1074415982 10:113267127-113267149 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1074665446 10:115717664-115717686 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1075046981 10:119154061-119154083 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1075253395 10:120903393-120903415 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1075362082 10:121847641-121847663 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1075422583 10:122313377-122313399 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1075648748 10:124113644-124113666 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1075807070 10:125196937-125196959 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1075850969 10:125586690-125586712 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1076577869 10:131482893-131482915 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1077026948 11:444228-444250 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1077057636 11:602875-602897 CCAGCGACTCAGGAGGCTGAGGG - Intronic
1077257539 11:1594401-1594423 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1077276202 11:1710259-1710281 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1077574611 11:3372844-3372866 CCATCTACTCCGGAGGCTGAGGG - Intronic
1077617670 11:3689753-3689775 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1077634991 11:3836240-3836262 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1077707365 11:4499847-4499869 CCAACTACTCAGGAGGCTGAAGG - Intergenic
1077848520 11:6051450-6051472 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1078217498 11:9324031-9324053 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1078232090 11:9452862-9452884 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1078383759 11:10868834-10868856 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1078669599 11:13353244-13353266 CAATCAACTCTGGCGACCAATGG - Intronic
1079198931 11:18357465-18357487 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1079406329 11:20149638-20149660 CCAGCTACTCAGGCTGCTGAGGG + Intergenic
1079443999 11:20543198-20543220 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1079562644 11:21841613-21841635 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1080038272 11:27732138-27732160 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1080248766 11:30209272-30209294 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1080361045 11:31514342-31514364 CCAGCTACTCAGGAGGCTGATGG + Intronic
1080463371 11:32475044-32475066 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1080632610 11:34092964-34092986 CCAACTACTCAGGAGGCTGAGGG - Intronic
1080876079 11:36275556-36275578 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1081010200 11:37801556-37801578 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1081047990 11:38299315-38299337 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1081237517 11:40663193-40663215 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1081868722 11:46373610-46373632 CCAGCTACTCAGGAGGCTGACGG - Intronic
1081903739 11:46652599-46652621 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1082054807 11:47805242-47805264 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1082858860 11:57834324-57834346 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1083402034 11:62430191-62430213 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1083604170 11:63967626-63967648 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1083785168 11:64940951-64940973 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1083875371 11:65521111-65521133 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1083973717 11:66099993-66100015 CCAGCTACTCAGGGGGCTGAGGG - Intronic
1084025690 11:66447560-66447582 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1084112144 11:67021421-67021443 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1084234333 11:67776780-67776802 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1084234545 11:67778544-67778566 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1084533316 11:69742192-69742214 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1084741486 11:71142384-71142406 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1085094062 11:73744394-73744416 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1085114725 11:73920735-73920757 CCAACTACTCAGGAGGCTGAGGG + Intronic
1085553221 11:77394728-77394750 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1085573227 11:77577886-77577908 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1085895243 11:80631252-80631274 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1086115346 11:83243774-83243796 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1087320602 11:96653230-96653252 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1087399351 11:97644792-97644814 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1087465764 11:98503339-98503361 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1087777657 11:102271381-102271403 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1088210380 11:107448228-107448250 CCAACTACTCAGGAGGCTGAGGG + Intronic
1088297151 11:108311581-108311603 CCAGCAACTCAGGAGGCTGAGGG + Intronic
1088361619 11:108996423-108996445 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1088689626 11:112314718-112314740 CCAGCGACTCAGGAGGCTGAAGG - Intergenic
1088853789 11:113727979-113728001 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1089385453 11:118064531-118064553 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1089536601 11:119164237-119164259 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1090303868 11:125673317-125673339 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1090480389 11:127062563-127062585 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1090709151 11:129370576-129370598 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1091161944 11:133431578-133431600 CCAGCTACTCAGGAGGCTGATGG - Intronic
1091460650 12:641728-641750 CCATCTACTCGGGAGGCTGAGGG + Intronic
1091574579 12:1721328-1721350 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1091863879 12:3812915-3812937 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1092113035 12:5977754-5977776 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1092187095 12:6488479-6488501 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1092267436 12:6993317-6993339 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1092275376 12:7056957-7056979 CCAGCTACTCAGGAGGCCAAGGG - Intronic
1092356579 12:7800583-7800605 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1092622556 12:10288126-10288148 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1092683725 12:11017597-11017619 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1093013910 12:14137156-14137178 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1093079725 12:14795613-14795635 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1093311840 12:17598149-17598171 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1093647618 12:21605944-21605966 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1093950121 12:25155988-25156010 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1094114351 12:26894193-26894215 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1094553574 12:31475632-31475654 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1094665884 12:32520548-32520570 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1095311312 12:40700409-40700431 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1095459310 12:42425499-42425521 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1095471674 12:42543635-42543657 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1095897460 12:47294084-47294106 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1096334622 12:50744114-50744136 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1096339322 12:50784046-50784068 CCAACTACTCAGGAGGCAGAAGG + Intronic
1096366423 12:51032117-51032139 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1096367889 12:51044169-51044191 CCAACTACTCAGGAGGCCAAGGG - Intergenic
1096417928 12:51429756-51429778 CCAGCACTTCAGGAGGCCGAGGG - Intronic
1096675981 12:53226240-53226262 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1096716582 12:53494993-53495015 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1096767851 12:53908492-53908514 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1096999283 12:55862872-55862894 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1097001438 12:55880336-55880358 CCAGCCACTCAGGAGGCTGAGGG + Intergenic
1097116952 12:56704589-56704611 CCAGCTACTCAGGAGGCTGATGG - Intergenic
1097199275 12:57264455-57264477 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1097219764 12:57441794-57441816 CCAACTACTCAGGAGGCTGAGGG - Intronic
1097334029 12:58362369-58362391 CCAGCCACTCAGGAGGCTGAGGG - Intergenic
1097594273 12:61608998-61609020 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1097858648 12:64494362-64494384 CCATCTACTCAGGAGGCTTAAGG + Intronic
1098297659 12:69020599-69020621 CCAGCAACTCAGGAGGCTGAGGG + Intergenic
1098359013 12:69637187-69637209 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1098633551 12:72754093-72754115 CCAGCTACTCAGAAGGCCGAGGG - Intergenic
1098655150 12:73019037-73019059 CCAGCTACTCAGGGGGCTGAGGG - Intergenic
1100588398 12:96000416-96000438 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1100722403 12:97372755-97372777 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1100843661 12:98638394-98638416 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1101147928 12:101858906-101858928 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1101890953 12:108714645-108714667 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1101891543 12:108720636-108720658 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1101902851 12:108804168-108804190 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1101927933 12:108988885-108988907 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1101928848 12:108995783-108995805 CCAGCAACTCAAGAGGCTGAGGG + Intronic
1102070155 12:110012248-110012270 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1102331584 12:112036731-112036753 CCACCTACTCAGGAGGCCGAGGG + Intronic
1102525228 12:113507856-113507878 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1102642944 12:114382680-114382702 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1102989949 12:117307898-117307920 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1103078985 12:118008436-118008458 CCAGCCACTCAGGAGGCTGACGG + Intergenic
1103114640 12:118316513-118316535 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1103151428 12:118642536-118642558 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1103375566 12:120452943-120452965 CCAACACTTCAGGAGGCCGAAGG - Intronic
1103456416 12:121070325-121070347 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1103522182 12:121543707-121543729 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1103617858 12:122166301-122166323 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1103622826 12:122199395-122199417 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1103650348 12:122427059-122427081 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1103724959 12:122992938-122992960 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1103766033 12:123280501-123280523 CCAGCTACTCGGGAGGCCGAGGG - Intergenic
1103770487 12:123319076-123319098 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1103903776 12:124316996-124317018 CCATCAAAGCAGGCAGCCGGTGG - Intergenic
1103959587 12:124600658-124600680 CCAACCACTCAGGAGGCTGAGGG - Intergenic
1104325875 12:127797881-127797903 CCAACTACTCAGGAGGCTGAGGG - Intergenic
1104426282 12:128681093-128681115 CCAGCTACTCAGGAGGCAGAGGG - Intronic
1104722322 12:131051596-131051618 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1105071654 12:133237402-133237424 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1105208755 13:18245133-18245155 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1105228391 13:18461264-18461286 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1105294786 13:19078379-19078401 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1105309983 13:19198044-19198066 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1105399994 13:20083175-20083197 CCAGCCACTCAGGAGGCTGAGGG - Intronic
1105400091 13:20084125-20084147 CCAGCAACTCAGGAGGCAGAGGG - Intronic
1105509196 13:21037287-21037309 CCAGCTACTCAGGAGGCTGACGG + Intronic
1106082820 13:26514668-26514690 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1106192863 13:27469195-27469217 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1106210393 13:27637878-27637900 CCAGCTACTCAGGAGGCTGATGG - Intronic
1106306760 13:28518543-28518565 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1106534532 13:30627989-30628011 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1106575834 13:30974004-30974026 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1106589587 13:31088101-31088123 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1107357454 13:39583285-39583307 CCAGCTACTCAGGGGGCTGAGGG - Intronic
1107540004 13:41380426-41380448 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1108134465 13:47340093-47340115 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1108178828 13:47821247-47821269 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1108194759 13:47981868-47981890 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1108696940 13:52910656-52910678 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1108752795 13:53465306-53465328 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1110075036 13:71229342-71229364 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1110363935 13:74660198-74660220 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1110911676 13:80973533-80973555 CCATCTACTCTGGAGGCTGAGGG - Intergenic
1111169531 13:84507846-84507868 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1111314578 13:86536335-86536357 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1111327620 13:86719822-86719844 CCAGCTACTCAGGAGGCAGAGGG + Intergenic
1111498578 13:89087129-89087151 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1111514716 13:89314027-89314049 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1111795691 13:92916790-92916812 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1111825048 13:93257184-93257206 CCAGCTACTCAGGAGGCTGACGG + Intronic
1111922755 13:94429956-94429978 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1112051559 13:95648294-95648316 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1112323265 13:98426373-98426395 CCAGCTACTCAGGGGGCTGAGGG + Intronic
1112461192 13:99605310-99605332 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1112554048 13:100450267-100450289 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1112609111 13:100938518-100938540 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1112681095 13:101765841-101765863 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1112844180 13:103617654-103617676 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1112992801 13:105534731-105534753 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1113240924 13:108336084-108336106 CCAGCAACACAGGCAGCCCAGGG + Intergenic
1113247391 13:108412871-108412893 AAATCAACTCAGGCGGCAGTAGG + Intergenic
1113833780 13:113315502-113315524 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1114038664 14:18655335-18655357 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1114291966 14:21295883-21295905 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1114303129 14:21396109-21396131 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1114476949 14:23002335-23002357 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1114927005 14:27415375-27415397 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1115120888 14:29936260-29936282 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1115195121 14:30790058-30790080 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1115241027 14:31251181-31251203 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1115697885 14:35920211-35920233 CCAACTACTCAGGAGGCTGAGGG + Intronic
1115781529 14:36774678-36774700 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1116030580 14:39566546-39566568 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1116351078 14:43863667-43863689 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1116452570 14:45081904-45081926 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1117267428 14:54104392-54104414 CCTTCAACTCAGGCAGCAAATGG + Intergenic
1118009971 14:61601006-61601028 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1118057793 14:62099761-62099783 CCAGCTACTCAGGAGGCTGATGG + Intronic
1118187147 14:63547825-63547847 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1118242303 14:64071901-64071923 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1118266015 14:64295238-64295260 CCATCTACTCAGGTGGCATAAGG + Intronic
1118398320 14:65356207-65356229 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1118805570 14:69233879-69233901 CCAGCTACTCAGGAGGCCTAAGG - Intronic
1118872116 14:69752187-69752209 CCAGCTACTCAGGTGGCTGAAGG + Intronic
1118953046 14:70452478-70452500 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1119365803 14:74090448-74090470 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1119377383 14:74205755-74205777 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1119718977 14:76878415-76878437 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1119726674 14:76925646-76925668 CAATCTACTCAGGAGGCTGAGGG + Intergenic
1119812221 14:77531626-77531648 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1120574797 14:86168867-86168889 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1121225125 14:92316049-92316071 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1121290679 14:92772382-92772404 CCAGCTACTCAGGAGGCAGAAGG + Intergenic
1121294588 14:92808117-92808139 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1121353099 14:93189810-93189832 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1121463025 14:94096577-94096599 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1121560872 14:94874337-94874359 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1122524092 14:102368121-102368143 CCAGCTACTCAGGAGGCCGAAGG - Intronic
1122753856 14:103961446-103961468 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1202881742 14_KI270722v1_random:67158-67180 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1123848143 15:24325586-24325608 CCAGCCACTCAGGAGGCTGAGGG - Intergenic
1124100224 15:26686055-26686077 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1124394951 15:29293360-29293382 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1124446206 15:29735472-29735494 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1124914697 15:33958474-33958496 CCAGCTACTCAGGTGGCTGAGGG + Intronic
1124951621 15:34327541-34327563 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1125277840 15:38012007-38012029 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1125484599 15:40103484-40103506 CCATCAACAAAGGCGGCGGCTGG - Intronic
1125491697 15:40153439-40153461 CCAGCAACTCGGGAGGCTGAGGG - Intergenic
1125564704 15:40667778-40667800 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1125588216 15:40837135-40837157 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1125593644 15:40871192-40871214 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1125635652 15:41186355-41186377 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1125915744 15:43485726-43485748 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1125934434 15:43622791-43622813 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1126187872 15:45848085-45848107 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1126536642 15:49773775-49773797 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1126642472 15:50841807-50841829 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1126770757 15:52053752-52053774 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1126797230 15:52269473-52269495 CCTTGAACTCAGGAGGCAGAGGG - Intronic
1126806506 15:52354737-52354759 CCATCTACTCAGGAGGCAGAGGG + Intronic
1126888664 15:53180249-53180271 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1126972472 15:54132183-54132205 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1127266782 15:57368768-57368790 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1127418646 15:58783032-58783054 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1127446273 15:59066493-59066515 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1127462175 15:59209426-59209448 CCAGCAATTTAGGAGGCCGAGGG + Intronic
1127878942 15:63138930-63138952 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1127881143 15:63159280-63159302 CCAACTACTCAGGAGGCTGAGGG - Intergenic
1127970133 15:63952123-63952145 CCAACTACTCAGGAGGCGGAGGG + Intronic
1127979277 15:64022702-64022724 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1128009964 15:64283596-64283618 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1128169176 15:65495487-65495509 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1128782003 15:70365724-70365746 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1128955739 15:71941318-71941340 CCAACTACTCAGGAGGCTGAGGG + Intronic
1129046805 15:72742701-72742723 CCAGCAAGTCAGGAGGCTGAGGG + Intergenic
1129284078 15:74509800-74509822 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1129494793 15:75968471-75968493 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1129944950 15:79531065-79531087 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1130291554 15:82606355-82606377 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1130349597 15:83079299-83079321 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1130604010 15:85298516-85298538 CCAGCTACTCAGGCGGCTGAGGG + Intergenic
1130607264 15:85329144-85329166 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1130860999 15:87889517-87889539 CCAGCAACTCAGGAGGCAGAAGG - Intronic
1131724464 15:95206726-95206748 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1131766171 15:95677979-95678001 CCAGCTACTCGGGAGGCCGAGGG + Intergenic
1131898117 15:97055769-97055791 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1132562999 16:607020-607042 ACCTCCACTCAGGTGGCCGAGGG + Intronic
1132811560 16:1801269-1801291 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1133213530 16:4276379-4276401 CCAGCAACTCAGGAGGCTGAGGG - Intergenic
1133219037 16:4310661-4310683 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1133226412 16:4342842-4342864 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1133240939 16:4414074-4414096 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1133290395 16:4716798-4716820 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1133419087 16:5630340-5630362 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1133456237 16:5944842-5944864 CCAGCTACTCAGGAGGCAGAAGG + Intergenic
1133647028 16:7774088-7774110 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1133748978 16:8709916-8709938 CCAGCTACTCAGGCGGCGGAGGG - Intronic
1133768229 16:8852477-8852499 CCAGCTACTCAGGTGGCTGAAGG + Intergenic
1133931265 16:10234075-10234097 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1134003532 16:10801569-10801591 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1134003920 16:10804629-10804651 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1134181471 16:12051212-12051234 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1134254850 16:12602464-12602486 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1134289271 16:12890737-12890759 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1134440413 16:14296450-14296472 CCATCAAGGCAGGCGGGCAAGGG + Intergenic
1134443597 16:14314099-14314121 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1134568218 16:15269421-15269443 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1134600163 16:15527488-15527510 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1134626755 16:15727856-15727878 CCAGCTACTCAGGAGGCGGATGG + Intronic
1134734215 16:16486939-16486961 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1134864747 16:17595311-17595333 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1134933285 16:18225342-18225364 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1135122114 16:19775110-19775132 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1135248687 16:20881290-20881312 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1135267375 16:21039331-21039353 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1135535840 16:23293807-23293829 CCAACTACTCAGGAGGCTGAGGG + Intronic
1135711294 16:24719543-24719565 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1135713520 16:24739591-24739613 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1135794408 16:25427246-25427268 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1135902522 16:26476245-26476267 CCAGCTACTCAGGGGGCAGATGG - Intergenic
1135930183 16:26729637-26729659 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1135935912 16:26779910-26779932 CCAGCAACTCAGGAGTCTGAGGG - Intergenic
1135957267 16:26966193-26966215 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1135959263 16:26982282-26982304 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1135995885 16:27247810-27247832 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1136176442 16:28520254-28520276 CCATCTACTCGGGCGGCTGAGGG + Intergenic
1136235896 16:28913594-28913616 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1136495490 16:30640929-30640951 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1136593969 16:31234142-31234164 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1136598874 16:31270626-31270648 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1136622795 16:31441594-31441616 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1136711955 16:32245723-32245745 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1136750642 16:32632634-32632656 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1136755961 16:32683683-32683705 CCAGCTACTCAGGAGGCTGACGG + Intergenic
1136812152 16:33186689-33186711 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1136818628 16:33296769-33296791 CCAGCTACTCAGGAGGCTGACGG - Intronic
1136825192 16:33353302-33353324 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1136830258 16:33452073-33452095 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1137668963 16:50268211-50268233 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1137692321 16:50437643-50437665 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1137773397 16:51036434-51036456 CCATCAACTCTGGAGTCCGATGG - Intergenic
1137991357 16:53159722-53159744 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1138000419 16:53272972-53272994 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1138103695 16:54275121-54275143 CCAGCAACTCAGGAGGCTGAGGG + Intergenic
1138112865 16:54338477-54338499 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1138613945 16:58149391-58149413 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1138628161 16:58269214-58269236 CCATCTACTCGGGAGGCTGAGGG + Intronic
1138638685 16:58364924-58364946 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1138665676 16:58565828-58565850 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1138675210 16:58646329-58646351 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1139120478 16:64010046-64010068 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1139130237 16:64134026-64134048 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1139744571 16:69063949-69063971 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1139760556 16:69181361-69181383 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1140083026 16:71768384-71768406 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1140546242 16:75812521-75812543 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1140805007 16:78525298-78525320 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1141114711 16:81298611-81298633 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1141126138 16:81402448-81402470 CCAGCTACTCAGGGGGCTGAGGG - Intergenic
1141710217 16:85694598-85694620 CCAGCTACTCAGGAGGCCAAGGG - Intronic
1142011415 16:87716679-87716701 CCAGCACTTCAGGAGGCCGAGGG + Intronic
1142208349 16:88794738-88794760 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1142374389 16:89699663-89699685 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1202990730 16_KI270728v1_random:9659-9681 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1203052771 16_KI270728v1_random:891840-891862 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1203058101 16_KI270728v1_random:944036-944058 CCAGCTACTCAGGAGGCTGACGG + Intergenic
1142469082 17:152655-152677 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1142511526 17:397412-397434 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1142512660 17:407128-407150 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1142686587 17:1580674-1580696 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1142710079 17:1718230-1718252 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1142754300 17:2006733-2006755 CTAGCTACTCAGGAGGCCGAGGG - Intronic
1142778999 17:2165788-2165810 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1142838407 17:2607286-2607308 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1142838519 17:2608197-2608219 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1143038014 17:4011286-4011308 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1143059128 17:4185318-4185340 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1143516566 17:7422137-7422159 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1143641135 17:8198242-8198264 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1143647067 17:8237548-8237570 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1143902758 17:10186516-10186538 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1144099168 17:11929147-11929169 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1144162082 17:12569631-12569653 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1144311894 17:14021611-14021633 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1144332865 17:14239707-14239729 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1144333868 17:14251268-14251290 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1144358167 17:14465744-14465766 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1144787309 17:17839227-17839249 CCATCTACTCGGGAGGCTGAGGG - Intergenic
1144801065 17:17927777-17927799 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1145743563 17:27295950-27295972 CCACCTACTCAGGAGGCTGAGGG - Intronic
1145920829 17:28608467-28608489 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1146134634 17:30308302-30308324 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1146214495 17:30968498-30968520 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1146302493 17:31700440-31700462 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1146684305 17:34830444-34830466 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1146703018 17:34978591-34978613 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1147279683 17:39348807-39348829 CTAGCTACTCAGGAGGCCGAAGG - Intronic
1147710833 17:42463115-42463137 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1147779518 17:42930326-42930348 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1147991974 17:44339617-44339639 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1148045818 17:44743723-44743745 CCAACCACTCAGGAGGCTGAGGG - Intronic
1148248485 17:46052848-46052870 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1148941191 17:51213151-51213173 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1149308201 17:55369496-55369518 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1149469615 17:56905247-56905269 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1149475160 17:56954720-56954742 CCAGCTACTCAGGAGGCAGAGGG + Intronic
1149526904 17:57363622-57363644 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1149928146 17:60722924-60722946 CCAGCAACTCAGGAGGTTGAGGG + Intronic
1150158266 17:62872092-62872114 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1150159769 17:62886398-62886420 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1150333177 17:64310896-64310918 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1150495473 17:65604834-65604856 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1150516842 17:65821664-65821686 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1150938782 17:69667434-69667456 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1151093973 17:71475249-71475271 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1151158971 17:72148948-72148970 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1151199469 17:72457213-72457235 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1151236263 17:72721853-72721875 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1151511869 17:74565728-74565750 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1151594087 17:75066292-75066314 CCAGCTACTCAGGAAGCCGAGGG - Intergenic
1151689072 17:75669357-75669379 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1151701981 17:75748246-75748268 CCAGCTACTCAGGCGGCTGAGGG + Intronic
1151739309 17:75968805-75968827 CCAGCTACTCAGGAGGCCGAGGG + Intronic
1151762929 17:76116984-76117006 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1151825944 17:76524377-76524399 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1152087414 17:78229046-78229068 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1152505508 17:80747100-80747122 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1152832455 17:82506322-82506344 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1152877071 17:82792875-82792897 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1153298443 18:3570815-3570837 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1153469757 18:5430676-5430698 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1153553710 18:6287926-6287948 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1153819335 18:8819715-8819737 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1154261022 18:12832901-12832923 CCAACTACTCAGGAGGCTGAGGG - Intronic
1154477522 18:14777826-14777848 CCAGCTACTCAGGAGGCAGAAGG + Intronic
1154525061 18:15279033-15279055 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1155187557 18:23400510-23400532 CCAGCTACTCAGGAGGCCAAGGG + Intronic
1155338006 18:24784894-24784916 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1155449392 18:25947438-25947460 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1155946010 18:31852224-31852246 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1156639114 18:39068453-39068475 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1156814106 18:41288002-41288024 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1156956209 18:42967482-42967504 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1157018192 18:43744698-43744720 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1157190342 18:45576396-45576418 CCAGCTACTCAGGAGACCGAGGG - Intronic
1157264072 18:46201890-46201912 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1157306744 18:46523060-46523082 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1157367301 18:47076934-47076956 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1157620139 18:49012340-49012362 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1157669776 18:49518657-49518679 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1157749519 18:50165659-50165681 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1157774509 18:50381838-50381860 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1158380770 18:56927497-56927519 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1158590943 18:58778305-58778327 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1158667374 18:59444630-59444652 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1158698601 18:59726041-59726063 CCAGCCACTCAGGAGGCTGAAGG - Intergenic
1159000504 18:62970648-62970670 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1159442557 18:68500001-68500023 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1159541418 18:69782324-69782346 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1159607862 18:70494325-70494347 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1159628475 18:70721945-70721967 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1159921453 18:74230709-74230731 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1159951932 18:74490629-74490651 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1160204100 18:76819486-76819508 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1160211425 18:76883536-76883558 CCAGCTACTCAGGAGGTCGAGGG - Intronic
1160459931 18:79031409-79031431 CCAGCTACTCAGGAGGCGGAAGG - Intergenic
1160711999 19:556405-556427 CCATCTCCTCAGGAGGCTGAGGG - Intergenic
1160729756 19:635856-635878 CCAGCTACTCAGGAGGCCAAGGG + Intergenic
1160787952 19:910208-910230 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1160798851 19:957995-958017 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1160923412 19:1531292-1531314 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1161034006 19:2073914-2073936 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1161034045 19:2074177-2074199 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1161052331 19:2171075-2171097 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1161180978 19:2881994-2882016 CCAGCTACTCAGGAGGCTGAGGG + Exonic
1161355200 19:3815202-3815224 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1161500491 19:4611854-4611876 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1161509867 19:4664373-4664395 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1161529508 19:4779120-4779142 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1161714802 19:5869363-5869385 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1161735407 19:5989339-5989361 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1161785534 19:6322995-6323017 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1161883169 19:6971970-6971992 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1162334044 19:10049245-10049267 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1162511698 19:11122923-11122945 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1162755240 19:12854236-12854258 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1162896882 19:13769803-13769825 CCAACTACTCAGGAGGCTGAGGG + Intronic
1162920390 19:13898365-13898387 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1163207640 19:15815224-15815246 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1163277099 19:16291773-16291795 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1163427891 19:17249032-17249054 CCAGTATCTCAGGAGGCCGAGGG - Intronic
1163461726 19:17442371-17442393 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1163470433 19:17493737-17493759 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1163519961 19:17786216-17786238 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1163524988 19:17815396-17815418 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1163754781 19:19100225-19100247 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1163859895 19:19737257-19737279 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1164002806 19:21120154-21120176 CCAGCTACTCAGGAGGCTGAGGG - Exonic
1164004434 19:21135761-21135783 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1164077369 19:21832748-21832770 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1164086443 19:21907102-21907124 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1164185089 19:22859513-22859535 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1164323555 19:24172233-24172255 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1164527039 19:29020238-29020260 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1164656744 19:29927376-29927398 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1164682904 19:30147779-30147801 CCAGCTACTCAGGTGGCTGAGGG - Intergenic
1164851735 19:31489849-31489871 CCATTAACTCAGGCTGACCAAGG - Intergenic
1164933228 19:32191379-32191401 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1164971423 19:32536110-32536132 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1164977420 19:32583710-32583732 CCAGCTACTCAGGAGGCCGAGGG + Intronic
1165381015 19:35480405-35480427 CCACCACTTCAGGAGGCCGAGGG - Intergenic
1165414630 19:35684952-35684974 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1165651957 19:37499093-37499115 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1165689469 19:37852231-37852253 CCAGCTACTCAGGAAGCCGAGGG - Intergenic
1165711920 19:38017638-38017660 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1165727303 19:38122104-38122126 CCAGCTACTCGGGAGGCCGAGGG + Intronic
1165770586 19:38377752-38377774 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1165883001 19:39056778-39056800 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1166349631 19:42189835-42189857 CCAGCTACTCAGGGGGCTGAGGG - Intronic
1166439385 19:42798023-42798045 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1166457422 19:42953571-42953593 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1166467753 19:43048001-43048023 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1166474369 19:43108791-43108813 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1166495011 19:43294345-43294367 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1166512998 19:43423271-43423293 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
1166554449 19:43688960-43688982 CCAGCTACTCAGGTGGCTGAGGG - Intergenic
1166674479 19:44731610-44731632 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1166715285 19:44963091-44963113 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1166731802 19:45063559-45063581 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1166797661 19:45437132-45437154 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1166875511 19:45894831-45894853 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1166968429 19:46545339-46545361 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1167074094 19:47238623-47238645 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1167138785 19:47634875-47634897 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1167140734 19:47648799-47648821 CCAGCTACTCAGGGGGCTGAGGG - Intronic
1167192315 19:47999935-47999957 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1167206929 19:48108812-48108834 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1167232297 19:48292610-48292632 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1167243409 19:48359052-48359074 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1167309031 19:48726039-48726061 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1167503420 19:49859660-49859682 GCTTCAACTCAGGAGCCCGAGGG - Intronic
1167671662 19:50857046-50857068 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1167686222 19:50958342-50958364 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1167949795 19:53016878-53016900 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1167973646 19:53205863-53205885 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1168128744 19:54303097-54303119 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1168197659 19:54787440-54787462 CTAGCAACTCAGGAGGCTGAGGG + Intronic
1168417909 19:56181040-56181062 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1168479277 19:56704891-56704913 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1168612381 19:57811601-57811623 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1202657353 1_KI270708v1_random:36255-36277 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
925045414 2:769655-769677 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
925250114 2:2425848-2425870 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
926017858 2:9470106-9470128 CCAACTACTCAGGAGGCTGAGGG + Intronic
926030320 2:9580904-9580926 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
926271148 2:11366980-11367002 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
926555069 2:14348035-14348057 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
926564974 2:14459040-14459062 CCAGCTACTCAGGAGGCTGATGG + Intergenic
926675492 2:15616005-15616027 CCAGCTACTCAGGAGGCTGAGGG - Intronic
926839642 2:17065519-17065541 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
926891191 2:17640133-17640155 CCAGCTACTCAGGAGGCTGAGGG + Intronic
927355950 2:22173469-22173491 TCAGCTACTCAGGAGGCCGAGGG - Intergenic
927523919 2:23720457-23720479 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
927722777 2:25397221-25397243 CCATCAATTCAGGAGGCCAAGGG + Intronic
927762560 2:25772614-25772636 CCAGCTACTCAGGAGGCTGAGGG + Intronic
928051253 2:27998036-27998058 CCAGCTACTCAGGAGGCTGAGGG + Intronic
928131644 2:28656022-28656044 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
928422638 2:31150876-31150898 CCAGCTACTCAGGAGGCTGAGGG - Intronic
928487397 2:31746624-31746646 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
928487421 2:31746803-31746825 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
928686347 2:33753972-33753994 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
928692541 2:33815800-33815822 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
928866181 2:35919866-35919888 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
929115136 2:38437723-38437745 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
929408239 2:41667369-41667391 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
929506604 2:42533189-42533211 CCAGCAACTCAGGAGGCTGAGGG - Intronic
929510243 2:42560790-42560812 CCAGCTACTCAGGAGGCTGAGGG + Intronic
929514743 2:42597017-42597039 CCAGCTACTCAGGAGGCTGAGGG - Intronic
929591245 2:43148408-43148430 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
929615007 2:43299545-43299567 CCAGCTACTCAGGAGGCTGAGGG + Intronic
930066842 2:47334217-47334239 CCAGCCACTCAGGAGGCTGAGGG - Intergenic
930108733 2:47659667-47659689 CCAGCCACTCAGGAGGCTGAAGG - Intergenic
930182673 2:48379679-48379701 CCATCTACCCAGGAGGCTGAGGG + Intergenic
930271026 2:49256997-49257019 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
930864793 2:56111724-56111746 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
931056938 2:58482896-58482918 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
931195856 2:60051846-60051868 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
931247260 2:60501619-60501641 CCAGCTACTCAGGAGGCTGAGGG - Intronic
931531385 2:63218642-63218664 CCAGCTACTCAGGAGGCTGATGG - Intronic
931762098 2:65427184-65427206 CCAGCTACTCAGGAGGCTGAGGG - Intronic
932333202 2:70912545-70912567 CCATCTACTCAGGAGGCTGAGGG + Intronic
932360558 2:71102219-71102241 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
932414445 2:71565193-71565215 CCAGCTACTCAGGAGGCTGAGGG - Intronic
932675685 2:73779034-73779056 CCAGCAACTTGGGCGGCTGAGGG + Intronic
932719188 2:74125119-74125141 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
932884470 2:75536218-75536240 CCAGCTACTCAGGAGGCTGAAGG + Intronic
933390886 2:81665201-81665223 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
933403832 2:81832686-81832708 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
933670790 2:85005401-85005423 CCAGCTACTCAGGAGGCTGAGGG - Intronic
933707521 2:85303143-85303165 CCAGCAACTCGGGAGGCTGAGGG - Intronic
934306543 2:91827978-91828000 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
934326713 2:92024764-92024786 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
934465088 2:94255311-94255333 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
935022469 2:99244995-99245017 CCAGCTACTCAGGAGGCTGAGGG + Intronic
935183309 2:100709072-100709094 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
935344735 2:102095886-102095908 CCAGCTACTCGGGAGGCCGAGGG + Intronic
935648292 2:105360184-105360206 CCAGCTACTCAGGAGGCTGAGGG + Intronic
935682324 2:105648503-105648525 CCAACTACTCAGGAGGCTGAGGG + Intergenic
936258503 2:110936960-110936982 CCAGCTACTCAGGAGGCTGAGGG - Intronic
936780031 2:116021651-116021673 CCTTCAACCCAGGAGGCGGAAGG - Intergenic
937169268 2:119849413-119849435 CCAGCTACTCAGGAGGCTGAGGG - Intronic
937383813 2:121407099-121407121 CCAGCTACTCAGGAGGCTGAGGG + Intronic
937435475 2:121877012-121877034 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
938106995 2:128538928-128538950 CCAGCACTTCAGGAGGCCGAGGG + Intergenic
938802691 2:134777548-134777570 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
938919481 2:135981779-135981801 CCAGCTACTCAGGAGGCTGATGG - Intronic
939231489 2:139431983-139432005 CCAGCTACTCAGGAGGCTGATGG - Intergenic
939410562 2:141819121-141819143 CCAGCTACTCAGGAGGCAGAGGG + Intronic
939574928 2:143884293-143884315 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
939911191 2:147985309-147985331 CCAGCTACTCAGGAGGCTGAGGG - Intronic
940206614 2:151209685-151209707 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
940454930 2:153884922-153884944 CCAGCTACTCAGGAGGCTGAAGG + Intronic
940590700 2:155721641-155721663 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
940921317 2:159310559-159310581 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
940936505 2:159501277-159501299 CCAGCTACTCAGGAGGCTGATGG + Intronic
940974884 2:159931417-159931439 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
941131523 2:161655926-161655948 CCATCTACTCAGGAGGCTGGGGG - Intronic
941513664 2:166445199-166445221 CCAGCTACTCGGGAGGCCGAGGG + Intronic
941774525 2:169377690-169377712 CCAGCCACTCAGGAGGCTGAGGG + Intergenic
941944119 2:171076101-171076123 CCAGCTACTCAGGGGGCTGAAGG + Intronic
942741422 2:179183726-179183748 CCAGCTACTCAGGAGGCTGAGGG + Intronic
943248688 2:185489325-185489347 CCAGCAACTCTGGAGGCTGAGGG + Intergenic
943319559 2:186431333-186431355 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
943375522 2:187071934-187071956 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
943708034 2:191056895-191056917 CCAGCTACTCAGGAGGCTGAGGG - Intronic
943745008 2:191452919-191452941 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
944577239 2:201101479-201101501 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
944696261 2:202202813-202202835 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
944796379 2:203190019-203190041 CCAGCTACTCAGGAGGCTGAGGG + Intronic
944999166 2:205330224-205330246 CCAGCTACTCAGGAGGCTGAGGG + Intronic
945079786 2:206077160-206077182 CCAGCTACTCAGGAGGCTGAGGG + Intronic
945092598 2:206189518-206189540 CCAGCTACTCAGGAGGCTGAGGG + Intronic
945225102 2:207525744-207525766 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
945462892 2:210131812-210131834 CCAGCTACTCAGGAGGCTGAGGG - Intronic
946084767 2:217159657-217159679 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
946137355 2:217658202-217658224 CCAGCTACTCAGGAGGCTGAGGG + Intronic
946503139 2:220271200-220271222 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
946656704 2:221956102-221956124 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
947141590 2:227023889-227023911 CCAGCTACTCAGGAGGCTGAGGG + Intronic
947970200 2:234317032-234317054 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
948298045 2:236878132-236878154 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
948452657 2:238086589-238086611 CCAGCTACTCAGGAGGCTGAGGG + Intronic
948515736 2:238502940-238502962 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
948823617 2:240563314-240563336 CCAGCCACTCAGGAGGCTGAAGG - Exonic
949023420 2:241753849-241753871 CCATAAACTCACGCAGCAGAAGG + Intronic
1169099279 20:2931831-2931853 CCAGCAACTCAGGAGGCCTGAGG - Intronic
1169169817 20:3455877-3455899 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1169258860 20:4120745-4120767 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1169378241 20:5084646-5084668 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1169445963 20:5671345-5671367 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1169634995 20:7680165-7680187 CCAGCTACTCAGGTGGCTGAGGG - Intergenic
1169695422 20:8382395-8382417 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1170233890 20:14080326-14080348 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1170275165 20:14577665-14577687 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1171289924 20:23976842-23976864 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1171481234 20:25457207-25457229 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1171953030 20:31438405-31438427 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1172080564 20:32337575-32337597 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1172290863 20:33775812-33775834 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1172538328 20:35691624-35691646 CCAACTACTCAGGAGGCTGAGGG + Intronic
1172671542 20:36637739-36637761 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1172729682 20:37075568-37075590 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1172734042 20:37112592-37112614 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1172815138 20:37680319-37680341 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1172920610 20:38478729-38478751 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1173137935 20:40457047-40457069 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1173487302 20:43450643-43450665 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1173517483 20:43675092-43675114 CCAGCTACTCAGGAGGCTGACGG - Intronic
1173686366 20:44926339-44926361 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1173779110 20:45738721-45738743 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1174028921 20:47604980-47605002 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1174259310 20:49282239-49282261 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1174316959 20:49710966-49710988 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1174429615 20:50458367-50458389 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1174590532 20:51641242-51641264 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1174601734 20:51730351-51730373 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1175070492 20:56329356-56329378 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1175106989 20:56622485-56622507 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1175204563 20:57301842-57301864 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1175324702 20:58115144-58115166 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1176148397 20:63575664-63575686 CCAGCGACTCAGGAGGCTGAGGG - Intergenic
1176596117 21:8698531-8698553 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1176772372 21:13089450-13089472 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1177151414 21:17458971-17458993 CCATGTACTCAGGAGGCTGAGGG + Intergenic
1177159260 21:17530061-17530083 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1177405838 21:20666981-20667003 CCAACTACTCAGGAGGCTGAGGG - Intergenic
1177743595 21:25183971-25183993 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1177831087 21:26139776-26139798 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1177836679 21:26192598-26192620 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1178064296 21:28886969-28886991 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1178300422 21:31448489-31448511 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1178315279 21:31561577-31561599 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1178316457 21:31570349-31570371 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1178522188 21:33295555-33295577 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1178845161 21:36168639-36168661 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1178951918 21:36992285-36992307 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1179290974 21:40017664-40017686 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1179399780 21:41073234-41073256 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1179663231 21:42891840-42891862 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1180279028 22:10675980-10676002 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1180767504 22:18354191-18354213 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1180778802 22:18508197-18508219 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1180794558 22:18595807-18595829 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1180811524 22:18765507-18765529 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1180862135 22:19089693-19089715 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1180866717 22:19123776-19123798 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1180932385 22:19601366-19601388 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1181141916 22:20811896-20811918 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1181197677 22:21199759-21199781 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1181251469 22:21535328-21535350 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1181295357 22:21834039-21834061 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1181296268 22:21842105-21842127 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1181395898 22:22621525-22621547 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1181704024 22:24637148-24637170 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1182156800 22:28081605-28081627 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1182216909 22:28726252-28726274 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1182225055 22:28791271-28791293 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1182232423 22:28848796-28848818 CCAGCGACTCAGGAGGCCAAGGG + Intergenic
1182454634 22:30442251-30442273 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1182539430 22:31029710-31029732 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1182592370 22:31391462-31391484 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1182629665 22:31675457-31675479 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1182634226 22:31711667-31711689 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1182917147 22:34044813-34044835 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1182930802 22:34172539-34172561 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1183468280 22:37991228-37991250 CCACCTACTCAGGAGGCTGAGGG - Intronic
1183537533 22:38411898-38411920 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1183608810 22:38883710-38883732 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1183764985 22:39864775-39864797 CCAACTACTCAGGTGGCTGAGGG + Intronic
1183895330 22:40963732-40963754 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1183944565 22:41317667-41317689 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1183967551 22:41451402-41451424 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1184125195 22:42481800-42481822 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1184190282 22:42890114-42890136 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1184227827 22:43140287-43140309 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1184286433 22:43474332-43474354 CGATGATCTCAGGGGGCCGATGG + Intronic
1184382397 22:44153441-44153463 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1184531540 22:45059204-45059226 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1184751767 22:46490399-46490421 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1185078864 22:48698350-48698372 CCAGCTACTCAGGAGGCCAAGGG + Intronic
1185396189 22:50590807-50590829 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1203229126 22_KI270731v1_random:95077-95099 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
949135713 3:562581-562603 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
949319340 3:2791416-2791438 CCAGCTACTCAGGAGGCTGAAGG + Intronic
949507742 3:4742706-4742728 CCAGCTACTCAGGAGGCTGAGGG - Intronic
949612991 3:5722137-5722159 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
949994744 3:9607726-9607748 CCAGCCACTCAGGAGGCTGAGGG - Intergenic
950080014 3:10214977-10214999 CCAGCTACTCAGGAGGCTGATGG + Intronic
950289865 3:11774982-11775004 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
950293083 3:11803267-11803289 CCAGCTACTCAGGAGGCTGAAGG + Intronic
950889972 3:16395558-16395580 CCAGCCACTCAGGAGGCCGAGGG - Intronic
951344155 3:21525567-21525589 CCAGCTACTCAGGAGGCTGAGGG + Intronic
951360784 3:21721983-21722005 CCAGCTACTCAGGAGGCTGAGGG + Intronic
952262069 3:31749698-31749720 CCAGCTACTCAGGAGGCTGAGGG + Intronic
952265634 3:31783674-31783696 CCAGCTACTCAGGAGGCAGAGGG + Intronic
952467344 3:33603735-33603757 CCAGCTACTCAGGAGGCTGAGGG - Intronic
952766129 3:36955863-36955885 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
952806777 3:37362895-37362917 CCAGCTACTCAGGAGGCTGAGGG - Intronic
952958130 3:38572998-38573020 CCAGCTACTCAGGAGGCTGAGGG - Intronic
953036439 3:39215544-39215566 CCAGCTACTCAGGTGGCTGAGGG + Intergenic
953061472 3:39431555-39431577 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
953156629 3:40381045-40381067 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
953630741 3:44614571-44614593 CCAGCTACTCAGGAGGCTGAGGG - Intronic
954024953 3:47775655-47775677 CCAGCTACTCAGGCGGCTGAGGG + Intronic
954072514 3:48153215-48153237 CCAGCTACTCAGGGGGCTGAGGG + Intergenic
954114094 3:48454975-48454997 CCAGCTACTCAGGAGGCTGAAGG - Intronic
954121052 3:48500370-48500392 CCAGCTACTCAGGAGGCTGAGGG + Intronic
954340931 3:49953332-49953354 CCAGCTACTCAGGAGGCTGAGGG - Intronic
954393836 3:50281965-50281987 CCAGCTACTCAGGAGGCTGAAGG - Intronic
954485271 3:50844328-50844350 CCAGCTACTCAGGAGGCTGAGGG - Intronic
954507337 3:51089785-51089807 CCAGCTACTCAGGAGGCTGAGGG + Intronic
954781546 3:53065797-53065819 CCATCTACTCGGGAGGCTGAGGG - Intronic
954805351 3:53216567-53216589 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
955372322 3:58363435-58363457 CCAGCTACTCAGGAGGCAGAGGG - Intronic
955403554 3:58610722-58610744 CCATCCACTCAGGTGGAAGAGGG - Intronic
955568304 3:60273493-60273515 CCAGCTACTCAGGAGGCTGAGGG + Intronic
955625990 3:60919917-60919939 CCAGCTACTCAGGAGGCTGAGGG + Intronic
955906801 3:63815899-63815921 CCAGCTACTCAGGAGGACGAGGG - Intergenic
956572399 3:70711828-70711850 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
956617109 3:71183382-71183404 CCAGCTACTCAGGAGGCTGAGGG + Intronic
956759847 3:72430985-72431007 CCAGCTACTCAGGAGGCTGAAGG + Intronic
956766732 3:72490630-72490652 CCAGCGACTCAGGAGGCTGAGGG + Intergenic
958933232 3:100229863-100229885 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
959058001 3:101587133-101587155 CCAGCTACTCAGGAGGCTGAGGG + Intronic
959058799 3:101596855-101596877 CCAGCTACTCAGGGGGCTGAGGG - Intergenic
959918111 3:111841212-111841234 CCAGCTACTCAGGAGGCTGAGGG - Intronic
960102392 3:113758027-113758049 CCAGCTACTCAGGAGGCTGAGGG + Intronic
960731031 3:120726627-120726649 CCATCTACTCAGGAGGCTGAGGG + Intronic
961229263 3:125287522-125287544 CCAGCTACTCAGGAGGCTGAGGG + Intronic
961728993 3:128953398-128953420 CCAGCTACTCAGGAGGCTGAGGG + Intronic
962305674 3:134283884-134283906 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
962562696 3:136623838-136623860 CCATCTACTCAGGAGGTTGAGGG + Intronic
962763512 3:138540374-138540396 CCAGCTACTCAGGAGGCTGAAGG + Intronic
962868850 3:139470691-139470713 CCAGCTACTCAGGAGGCTGAGGG - Intronic
963041076 3:141070443-141070465 CCAGCTACTCAGGAGGCTGAGGG - Intronic
963427543 3:145151421-145151443 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
963840637 3:150102243-150102265 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
964344135 3:155738834-155738856 CCAGCTACTCAGGAGGCTGAGGG + Intronic
964560687 3:157992556-157992578 CCATCTACTCAGGAGGCTGAGGG + Intergenic
964581283 3:158241332-158241354 CCAGCTACTCAGGAGGCTGAGGG + Intronic
964665655 3:159169398-159169420 CCAGCTACTCAGGAGGCTGAGGG - Intronic
964854671 3:161133895-161133917 CCAGCTACTCAGGAGGCTGAGGG - Intronic
965082029 3:164046065-164046087 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
965646947 3:170893916-170893938 CCAGCTACTCAGGAGGCTGAGGG + Intronic
965850493 3:173016897-173016919 CCAGCTACTCAGGAGGCTGAGGG + Intronic
966286488 3:178302210-178302232 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
966367726 3:179207923-179207945 CCAGCAACTCAGGAGGCTAAGGG + Intronic
966614932 3:181903214-181903236 CCAGCAACTCAGGAGGCTGAGGG - Intergenic
967025058 3:185557510-185557532 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
967047670 3:185752709-185752731 CCAGCTACTCAGGAGGCTGAGGG - Intronic
967074404 3:185989286-185989308 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
967394879 3:188996994-188997016 CCAGCTACTCAGGAGGCTGAGGG - Intronic
967739978 3:192994390-192994412 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
967815767 3:193796957-193796979 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
967987663 3:195107357-195107379 CCAGCTACTCAGGAGGCTGAGGG + Intronic
968093381 3:195911308-195911330 CCAGCTACTCGGGAGGCCGAGGG + Intronic
968157960 3:196398744-196398766 CCAGCTACTCAGGAGGCCGAGGG - Intronic
968169412 3:196497553-196497575 CCAGCTACTCAGGAGGCTGAGGG + Intronic
968214472 3:196876765-196876787 CCAGCTACTCAGGAGGCTGAGGG + Intronic
968991396 4:3915759-3915781 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
969406378 4:6995625-6995647 CCAGCTACTCAGGAGGCTGAGGG - Intronic
969432104 4:7161362-7161384 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
969820819 4:9718974-9718996 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
969828083 4:9774106-9774128 CCAGCTACTCAGGAGGCTGAGGG - Intronic
969862158 4:10046157-10046179 CTATCTACTCAGGAGGCTGAGGG - Intronic
970264290 4:14264341-14264363 CCAGCAACTCAGGAGGCTGAAGG - Intergenic
971023804 4:22567622-22567644 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
971163587 4:24159323-24159345 CCAGCTACTCAGGAGGCCGAGGG - Intergenic
971317409 4:25579131-25579153 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
971856491 4:32051395-32051417 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
972328742 4:38043466-38043488 CCAGCTACTCTGGGGGCCGAGGG + Intronic
972506723 4:39726708-39726730 CCAGCTACTCAGGAGGCTGAGGG - Intronic
972523631 4:39885838-39885860 CCATCTACTCTGGAGGCTGAGGG + Intronic
972774813 4:42230981-42231003 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
972804886 4:42519202-42519224 CCAGCTACTCAGGAGGCCTAAGG - Intronic
972988681 4:44797475-44797497 CCAGCTACTCAGGCAGCTGAGGG + Intergenic
973299304 4:48561899-48561921 CCAGCTACTCAGGAGGCTGAGGG + Intronic
973731809 4:53829982-53830004 CCAGCTACTCAGGAGGCTGAGGG - Intronic
973939126 4:55886436-55886458 CCATCTACTCAGGAGGCTGAGGG + Intronic
974028299 4:56753764-56753786 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
974054793 4:56974814-56974836 CCAGCTACTCAGGAGGCTGAGGG - Intronic
974054955 4:56975759-56975781 CCAGCTACTCAGGAGGCTGAGGG + Intronic
975162554 4:71140304-71140326 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
975568342 4:75784675-75784697 CCAACTACTCAGGAGGCTGAAGG + Intronic
975789679 4:77935507-77935529 CCAGCTACTCATGAGGCCGAGGG - Intronic
975836555 4:78428435-78428457 CCAGCTACTCAGGAGGCTGAGGG - Intronic
975960875 4:79903032-79903054 CCAGCTACTCAGGAGGCTGAGGG + Intronic
976625849 4:87180919-87180941 CCAGCTACTCAGGGGGCTGAGGG + Intronic
976640637 4:87333989-87334011 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
977250575 4:94684217-94684239 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
977449821 4:97180831-97180853 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
977815904 4:101413619-101413641 CCAGCTACTCAGGAGGCTGAGGG + Intronic
978026973 4:103888492-103888514 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
978785826 4:112608503-112608525 CCAGCTACTCAGGAGGCTGAGGG + Intronic
979824060 4:125211119-125211141 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
980513829 4:133827091-133827113 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
980565708 4:134537468-134537490 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
980590752 4:134885019-134885041 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
980648896 4:135684520-135684542 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
981176149 4:141686178-141686200 CCAGCTACTCAGGAGGCTGAGGG + Intronic
982155784 4:152519181-152519203 CCAGCTACTCAGGAGGCTGAGGG + Intronic
982199573 4:152947102-152947124 CCAGCTACTCAGGAGGCTGAGGG + Intronic
982260880 4:153493229-153493251 CCAGCTACTCAGGAGGCTGAGGG + Intronic
982317821 4:154048929-154048951 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
982434949 4:155374222-155374244 CCAGCTACTCAGGAGGCTGAAGG + Intronic
982901462 4:161009497-161009519 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
983309338 4:166037691-166037713 CCAGCTACTCAGGAGGCTGAGGG + Intronic
983481308 4:168277692-168277714 CCAGCTACTCAGGAGGCTGAGGG + Intronic
983501411 4:168503825-168503847 CCATCAGCTCAGGCTGTCCACGG + Intronic
983573286 4:169233132-169233154 CCAGCTACTCAGGGGGCTGAGGG + Intronic
983640150 4:169937615-169937637 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
984058064 4:174953822-174953844 CCAGCTACTCAGGAGGCTGAGGG - Intronic
984273176 4:177573412-177573434 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
984286534 4:177736798-177736820 CCAGCTACTCAGGAGGCTGAGGG - Intronic
984799635 4:183702227-183702249 CCAGCTACTCAGGAGGCTGAGGG + Intronic
984910916 4:184673537-184673559 CCAGCTACTCAGGAGGCTGAGGG - Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
985696055 5:1340878-1340900 CCAGCTACTCAGGAGGCTGAGGG - Intronic
985739410 5:1606242-1606264 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
985864931 5:2507185-2507207 CCATCTACTCGGGAGGCTGAGGG - Intergenic
985907049 5:2847081-2847103 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
986465414 5:8016569-8016591 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
986491485 5:8295786-8295808 CCATCACTTTAGGAGGCCGAGGG + Intergenic
986914896 5:12607548-12607570 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
987301160 5:16599091-16599113 CCAGCTACTCAGGAGGCTGATGG + Intronic
987319721 5:16757173-16757195 CCAGCTACTCAGGAGGCTGAGGG + Intronic
987371546 5:17198072-17198094 CCAGCTACTCAGGAGGCTGAGGG + Intronic
987588459 5:19890707-19890729 CCAACTACTCAGGAGGCTGAGGG - Intronic
987709670 5:21491791-21491813 CCAGCTACTCAGGAGGCCAAGGG - Intergenic
987771543 5:22311585-22311607 CCAGCTACTCAGGAGGCTGAGGG + Intronic
987825935 5:23030453-23030475 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
988251772 5:28768429-28768451 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
988483014 5:31645449-31645471 CCAGCTACTCAGGAGGCTGAGGG - Intronic
988526839 5:31994598-31994620 CCAGCTACTCAGGAGGCTGAGGG - Intronic
988749943 5:34182371-34182393 CCAGCTACTCAGGAGGCCAAGGG + Intergenic
988787800 5:34580317-34580339 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
989477645 5:41892473-41892495 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
990216652 5:53540433-53540455 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
990287498 5:54314421-54314443 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
990362298 5:55032615-55032637 CCACCTACTCAGGAGGCTGAGGG + Intronic
990436249 5:55795078-55795100 CCAGCCACTCAGGAGGCTGAGGG - Intronic
990617058 5:57518945-57518967 CCAGCACCTCGGGAGGCCGAGGG + Intergenic
991060924 5:62374810-62374832 CCAGCTACTCAGGAGGCTGAGGG + Intronic
991089960 5:62684805-62684827 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
991341393 5:65614618-65614640 CCAGCCACTCAGGAGGCTGAGGG + Intronic
991342667 5:65628584-65628606 CCAGCTACTCAGGAGGCTGAGGG - Intronic
991394392 5:66188636-66188658 CCAACTACTCAGGAGGCTGAAGG - Intergenic
991396717 5:66211507-66211529 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
991734335 5:69617777-69617799 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
991780644 5:70128948-70128970 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
991810768 5:70472912-70472934 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
991859932 5:71004371-71004393 CCAGCTACTCAGGAGGCTGAAGG + Intronic
991873092 5:71129267-71129289 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
991904945 5:71500438-71500460 CCAGCCACTCAGGAGGCTGAGGG - Intronic
992224522 5:74607146-74607168 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
992236697 5:74717073-74717095 CCAGCTACTCGGGCGGCTGAGGG + Intronic
992248887 5:74857434-74857456 CCAGCTACTCAGGGGGCTGAGGG + Intronic
992316004 5:75555660-75555682 CCAGCTACTCGGGAGGCCGAGGG - Intronic
992522894 5:77574181-77574203 CCAGCTACTCAGGAGGCTGAGGG + Intronic
992691023 5:79240128-79240150 CCAGCTACTCAGGAGGCTGAGGG - Intronic
992717445 5:79525075-79525097 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
992993213 5:82306636-82306658 CCAGCTACTCAGGAGGCTGAGGG - Intronic
993274457 5:85838310-85838332 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
994099142 5:95875657-95875679 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
994411166 5:99408953-99408975 CCAGCCACTCAGGAGGCTGAGGG + Intergenic
994971726 5:106748000-106748022 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
995077362 5:108002128-108002150 CCAGCTACTCAGGAGGCTGAGGG - Intronic
995140871 5:108733626-108733648 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
996266972 5:121553302-121553324 CCAGCTACTCAGGAGGCCTAGGG + Intergenic
997129253 5:131260506-131260528 CCAGCTACTCAGGAGGCTGAAGG + Intronic
997489101 5:134257869-134257891 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
997569486 5:134915198-134915220 CCAGCTACTCAGGAGGCTGAGGG + Intronic
997649489 5:135504987-135505009 CCAGCCACTCAGGAGGCTGAAGG + Intergenic
997957915 5:138294617-138294639 CCAGCTACTCAGGAGGCTGAGGG - Intronic
998122827 5:139593108-139593130 CCAGCTACTCAGGAGGCTGAGGG - Intronic
998497080 5:142600245-142600267 CCAGCTACTCAGGGGGCTGAGGG + Intronic
999135048 5:149313010-149313032 CCAGCTACTCAGGAGGCTGAGGG + Intronic
999151870 5:149431675-149431697 CCAGCTACTGAGGAGGCCGACGG + Intergenic
999601388 5:153270018-153270040 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
999995829 5:157091328-157091350 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1000072391 5:157752729-157752751 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1000347717 5:160328763-160328785 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1000497573 5:162003841-162003863 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1000572086 5:162927165-162927187 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1000636031 5:163644838-163644860 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1000655637 5:163875105-163875127 CCAGCAACTCAAGAGGCTGAGGG - Intergenic
1001103656 5:168834575-168834597 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1001183145 5:169539833-169539855 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1001458474 5:171886898-171886920 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1001499950 5:172223482-172223504 CCAGCTACTCAGGAGGCTGATGG + Intronic
1001787754 5:174428163-174428185 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1001807732 5:174602548-174602570 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1001935518 5:175700771-175700793 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1002178537 5:177417097-177417119 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1002262179 5:178001391-178001413 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1002544695 5:179932370-179932392 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1002622752 5:180500547-180500569 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1002990473 6:2233703-2233725 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1003536996 6:6983941-6983963 CCAGCAACTCGGGAGGCTGAGGG + Intergenic
1003883581 6:10500275-10500297 CCAGCAACCCAGGGGGCTGAGGG + Intronic
1004182516 6:13393239-13393261 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1004368276 6:15030310-15030332 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1004370829 6:15050742-15050764 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1004586372 6:17005465-17005487 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1004676571 6:17848678-17848700 CCAGCTACTCAGGAGGCCAAGGG - Intronic
1005316862 6:24611382-24611404 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1005318203 6:24624948-24624970 CCACCTACTCAGGAGGCTGAGGG + Intronic
1005704626 6:28439199-28439221 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1005823207 6:29615168-29615190 CCAACTACTCAGGAGGCTGAGGG + Intronic
1006293493 6:33158745-33158767 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1006533949 6:34682370-34682392 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1006773215 6:36571116-36571138 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1007440427 6:41854885-41854907 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1007456422 6:41981317-41981339 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1007586739 6:42995244-42995266 CCAGCTACTCAGGGGGCTGAGGG - Intronic
1007587009 6:42997305-42997327 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1007608549 6:43133456-43133478 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1008019697 6:46562135-46562157 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1008091605 6:47299377-47299399 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1008456548 6:51717295-51717317 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1008458419 6:51739343-51739365 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1008569377 6:52800994-52801016 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1009518358 6:64649452-64649474 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1009788302 6:68366673-68366695 CCATCTACTCAGGAGGGTGAGGG - Intergenic
1010005928 6:70994907-70994929 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1010206877 6:73330360-73330382 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1010414085 6:75593827-75593849 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1010428414 6:75750691-75750713 CCAGCCACTCGGGCGGCTGAGGG - Intronic
1010518898 6:76809107-76809129 CCAGCAACTCAGGAGGGTGAAGG - Intergenic
1010673775 6:78717891-78717913 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1010750436 6:79611523-79611545 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1010783323 6:79970958-79970980 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1010982324 6:82382217-82382239 CCAGCTACTCAGGAGGCAGAGGG - Intergenic
1011036900 6:82987057-82987079 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1011282388 6:85689954-85689976 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1011454693 6:87535789-87535811 CCAGCTACTCAGGAGGCCGAGGG - Intronic
1011481419 6:87797506-87797528 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1011644557 6:89445559-89445581 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1011739193 6:90342413-90342435 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1012191200 6:96282138-96282160 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1012298190 6:97550389-97550411 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1012323792 6:97887953-97887975 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1013334348 6:109140205-109140227 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1013468428 6:110438439-110438461 CCAGCAACTCAAGAGGCTGAGGG - Intronic
1013502293 6:110764834-110764856 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1014204937 6:118647474-118647496 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1015038593 6:128688657-128688679 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1015522823 6:134148395-134148417 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1015532798 6:134237560-134237582 CCAGCTACTCAGGAGGCAGAGGG + Intronic
1015535757 6:134266096-134266118 CCAGCCACTCAGGAGGCTGAGGG - Intronic
1015597949 6:134883913-134883935 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1015628673 6:135208492-135208514 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1015673366 6:135717627-135717649 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1015951555 6:138558536-138558558 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1015957308 6:138611993-138612015 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1015983832 6:138866260-138866282 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1016489251 6:144578447-144578469 CCAGCTACTCAGGTGGCTGAGGG - Intronic
1016759777 6:147724240-147724262 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1016884463 6:148946394-148946416 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1016960953 6:149672322-149672344 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1017093185 6:150779849-150779871 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1017165065 6:151400367-151400389 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1017374328 6:153750609-153750631 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1017449555 6:154541815-154541837 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1017526698 6:155247441-155247463 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1017830054 6:158118501-158118523 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1017919702 6:158860633-158860655 CCATCAGCTCAGGCTCCCAAAGG - Intergenic
1018091898 6:160352933-160352955 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1018188521 6:161288592-161288614 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1018272672 6:162096989-162097011 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1018638184 6:165883425-165883447 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1019429856 7:993659-993681 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1019548388 7:1589961-1589983 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1019680263 7:2343916-2343938 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1020001742 7:4759914-4759936 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1020004816 7:4776836-4776858 GCATGAACCCAGGAGGCCGAGGG + Intronic
1020063816 7:5172238-5172260 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1020085883 7:5310025-5310047 CCATCAACTCAGGCGGCCGAGGG - Intronic
1020191211 7:5999538-5999560 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1020221554 7:6242489-6242511 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1020354219 7:7259367-7259389 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1020657647 7:10946244-10946266 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1021515420 7:21478951-21478973 CCAGCAACTCGGGAGGCTGAGGG + Intronic
1021796197 7:24256824-24256846 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1021905865 7:25332590-25332612 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1022484788 7:30770162-30770184 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1022521713 7:31012596-31012618 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1022661988 7:32376040-32376062 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1022688159 7:32616097-32616119 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1022953306 7:35358984-35359006 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1023024438 7:36037974-36037996 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1023318179 7:38963418-38963440 CCAGCAACTCAGGAGGCTGATGG + Intergenic
1023395916 7:39751884-39751906 CCAGCTACTCAGGAGGCAGAGGG + Intergenic
1023454225 7:40321188-40321210 CCAGCTACTCAGGAGGCCGAGGG - Intronic
1023563154 7:41496585-41496607 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1023605117 7:41923706-41923728 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1023694857 7:42834271-42834293 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1023800602 7:43830805-43830827 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1023951982 7:44853470-44853492 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1024185505 7:46944657-46944679 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1024255025 7:47534157-47534179 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1025208421 7:57007125-57007147 CCATCAACTCAGGCGGCCGAGGG + Intergenic
1025663529 7:63569753-63569775 CCATCAACTCAGGCGGCCGAGGG - Intergenic
1025721184 7:64016251-64016273 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1025778801 7:64581249-64581271 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1025938358 7:66055063-66055085 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1025946160 7:66106512-66106534 CCACCTACTCAGGAGGCCGAGGG - Intronic
1025976398 7:66373790-66373812 CCAGCGACTCAGGAGGCTGAGGG - Intronic
1026046625 7:66910032-66910054 CCAGCTACTCAGGAGGCGGAAGG - Intergenic
1026127397 7:67591443-67591465 CCAGCAGTTCAGGAGGCCGAGGG + Intergenic
1026153215 7:67805646-67805668 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1026156227 7:67828155-67828177 CCAGCTACTCAGGAGGCTGATGG - Intergenic
1026164219 7:67895760-67895782 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1026271414 7:68840266-68840288 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1026272431 7:68848308-68848330 CCAGCCACTCAGGAGGCTGAGGG - Intergenic
1026285135 7:68956174-68956196 TCAGCTACTCAGGAGGCCGAGGG - Intergenic
1026647160 7:72181590-72181612 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1026932788 7:74233713-74233735 CCAGCTACTCGGGCGGCTGAGGG - Intronic
1026982402 7:74534485-74534507 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1027212462 7:76161981-76162003 CCAGCTACTCAGGAGGCCAAGGG - Intergenic
1027213672 7:76169818-76169840 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1027254530 7:76422562-76422584 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1027346643 7:77267105-77267127 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1027392650 7:77720869-77720891 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1027870517 7:83701077-83701099 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1028143287 7:87294421-87294443 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1028304855 7:89250071-89250093 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1028787624 7:94813908-94813930 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1029023051 7:97385601-97385623 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1029040567 7:97568991-97569013 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1029090535 7:98044660-98044682 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1029217099 7:98958412-98958434 CCAGCAACTCAGGAGGCTGAGGG - Intronic
1029231384 7:99071962-99071984 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1029244436 7:99188790-99188812 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1029254585 7:99260950-99260972 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1029379919 7:100206584-100206606 CCAACTACTCAGGAGGCTGAGGG - Intronic
1029497374 7:100903298-100903320 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1029541825 7:101187865-101187887 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1029706974 7:102281253-102281275 CCAGCTACTCAGGAGGCTGACGG + Intronic
1030034245 7:105395056-105395078 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1030665403 7:112272606-112272628 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1031018627 7:116602717-116602739 CCATTTACTCAGGAGGCTGAAGG - Intergenic
1031033779 7:116765183-116765205 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1031128779 7:117806871-117806893 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1031140471 7:117936995-117937017 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1031222564 7:118988689-118988711 CTATCTACTCAGGAGGCTGATGG + Intergenic
1031400950 7:121325924-121325946 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1031647157 7:124240526-124240548 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1031717739 7:125129691-125129713 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1032105409 7:129024885-129024907 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1032223510 7:130011745-130011767 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1032299941 7:130677537-130677559 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1032339977 7:131061664-131061686 CCAGCTACTCGGGAGGCCGAGGG + Intergenic
1032619563 7:133514277-133514299 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1032742500 7:134752893-134752915 CCAGCTACTCAGGAGGCTGAAGG + Intronic
1032822213 7:135534498-135534520 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1033138613 7:138805278-138805300 CCAGCTACTCAGGAGGCTGAGGG + Exonic
1033173570 7:139105097-139105119 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1033216584 7:139497734-139497756 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1033344422 7:140516231-140516253 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1033364304 7:140659705-140659727 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1033570735 7:142626364-142626386 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1033931862 7:146532985-146533007 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1033950588 7:146780298-146780320 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1034172566 7:149073903-149073925 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1034577818 7:152016287-152016309 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1034614712 7:152405867-152405889 CCAGCTACTCGGGAGGCCGAGGG + Intronic
1034853225 7:154515588-154515610 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1035119468 7:156554152-156554174 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1035199323 7:157250299-157250321 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1035690057 8:1554171-1554193 CCAGCTACTCAGGAGGCCAAGGG + Intronic
1035811410 8:2494720-2494742 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1036148716 8:6278473-6278495 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1036391801 8:8330249-8330271 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1036433370 8:8709948-8709970 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1036559924 8:9892981-9893003 CCAGCAGCTCAGGAGGCTGAGGG - Intergenic
1036646730 8:10615641-10615663 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1036920314 8:12847529-12847551 CCATCTACTCAGGTGGCTGAGGG + Intergenic
1037272688 8:17146894-17146916 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1037465392 8:19154733-19154755 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1037519790 8:19669564-19669586 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1037972395 8:23182145-23182167 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1038524098 8:28258463-28258485 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1038655105 8:29443577-29443599 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1038805323 8:30785454-30785476 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1039178380 8:34834954-34834976 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1039381432 8:37089221-37089243 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1039982630 8:42421278-42421300 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1039984749 8:42437728-42437750 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1040037050 8:42880653-42880675 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1040357013 8:46628518-46628540 CCAGCAACTTAGGAGGCTGAGGG - Intergenic
1040396917 8:47009250-47009272 CCACCTACTCTGGCGGCTGAAGG + Intergenic
1040482446 8:47838495-47838517 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1040494701 8:47956245-47956267 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1040962811 8:53052800-53052822 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1041052062 8:53944421-53944443 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1041094418 8:54334906-54334928 GCAACTACTCAGGAGGCCGAGGG + Intergenic
1041118486 8:54563658-54563680 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1041137726 8:54778437-54778459 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1041213081 8:55572310-55572332 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1041608369 8:59813132-59813154 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1041656547 8:60356737-60356759 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1041724101 8:61002441-61002463 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1042247073 8:66718641-66718663 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1042255812 8:66802573-66802595 CCAGCTACTCAGGGGGCTGAGGG + Intronic
1042257255 8:66817599-66817621 CCAGCACTTCAGGAGGCCGAGGG - Intronic
1042345043 8:67718759-67718781 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1042403037 8:68371712-68371734 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1042540523 8:69903199-69903221 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1042546037 8:69952481-69952503 CCAGCTACTCAGGGGGCTGAGGG + Intergenic
1042562382 8:70082288-70082310 CCAGCTACTCAGGGGGCTGAGGG + Intergenic
1042914380 8:73860883-73860905 CCAGCACCTCAGGAGGCCAAGGG + Intronic
1043065991 8:75570651-75570673 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1043282140 8:78481198-78481220 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1043306453 8:78802543-78802565 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1043471483 8:80567294-80567316 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1044022097 8:87117282-87117304 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1044416621 8:91947263-91947285 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1044589885 8:93903939-93903961 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1044871902 8:96627966-96627988 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1044995720 8:97836293-97836315 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1045125825 8:99087695-99087717 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1045361722 8:101439078-101439100 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1045534611 8:103015751-103015773 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1045537302 8:103043435-103043457 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1045993307 8:108335129-108335151 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1046029757 8:108769211-108769233 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1046249180 8:111608712-111608734 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1046315785 8:112499992-112500014 CCAACTACTCAGGGGGCTGAGGG + Intronic
1046369666 8:113285373-113285395 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1046966252 8:120168968-120168990 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1047003252 8:120594176-120594198 CCAGCGACTCAGGAGGCTGAGGG - Intronic
1047639930 8:126807644-126807666 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1048011108 8:130456990-130457012 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1048595374 8:135860628-135860650 CCAGCGACTCAGGAGGCTGAGGG - Intergenic
1048680879 8:136840242-136840264 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1049057742 8:140252138-140252160 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1049144560 8:140989277-140989299 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1049145238 8:140995692-140995714 CCAGCTACTCAGGAGGCAGAAGG + Intronic
1049174502 8:141183358-141183380 CCAGCTAATCAGGAGGCCGAGGG - Intronic
1050063979 9:1739107-1739129 CCAACTACTCAGGAGGCTGAAGG + Intergenic
1050252642 9:3761289-3761311 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1050548186 9:6726848-6726870 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1050727018 9:8662029-8662051 CCAGCCACTCAGGAGGCTGAGGG - Intronic
1050729183 9:8688448-8688470 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1051210659 9:14738893-14738915 CCAGCTACTCAGGTGGCTGAGGG + Intronic
1051542563 9:18236183-18236205 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1052182477 9:25546652-25546674 CCAACTACTCAGGAGGCCGAGGG - Intergenic
1052185583 9:25589905-25589927 CCAGCTACTCAGGAGGCCAAGGG - Intergenic
1053179493 9:35956240-35956262 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1053207557 9:36199563-36199585 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1053244392 9:36522571-36522593 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1053248081 9:36551794-36551816 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1053249664 9:36564067-36564089 CTAGCTACTCAGGAGGCCGAGGG - Intergenic
1053258155 9:36636947-36636969 CCAGCTACTCGGGAGGCCGAGGG - Intronic
1053287657 9:36860220-36860242 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1053327756 9:37171530-37171552 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1053625146 9:39862605-39862627 CCAGCTACTCAGGAGGCTGACGG - Intergenic
1053695158 9:40632106-40632128 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1053879725 9:42580621-42580643 CCAGCTACTCAGGAGGCTGACGG + Intergenic
1053942147 9:43262492-43262514 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1054306402 9:63431331-63431353 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1054405141 9:64755323-64755345 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1054438767 9:65240813-65240835 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1054491637 9:65781133-65781155 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1054806917 9:69404278-69404300 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1055066011 9:72119253-72119275 CCAGCACTTCAGGAGGCCGAGGG + Intronic
1055070317 9:72159277-72159299 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1055155979 9:73063697-73063719 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1055214732 9:73845369-73845391 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1055383647 9:75737387-75737409 CCAGCTACTCGGGCGGCTGAGGG - Intergenic
1055571637 9:77623098-77623120 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1055637496 9:78293412-78293434 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1056164826 9:83930821-83930843 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1056337983 9:85595639-85595661 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1057530653 9:95842638-95842660 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1057712042 9:97454363-97454385 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1057764719 9:97906725-97906747 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1057782270 9:98059527-98059549 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1057827643 9:98383054-98383076 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1058009458 9:99960556-99960578 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1058368410 9:104235804-104235826 CCAGCACCTCAGAAGGCCGAGGG + Intergenic
1058704408 9:107626898-107626920 CCAGCACTTCAGGAGGCCGAGGG - Intergenic
1058830103 9:108808607-108808629 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1058902095 9:109451140-109451162 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1059005688 9:110399646-110399668 CCAGCGACTCAGGAGGCTGAGGG - Intronic
1059156135 9:111989893-111989915 CCAGCTACTCAGGAGGCTGAAGG - Intergenic
1059577708 9:115508426-115508448 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1059688185 9:116657997-116658019 CCAACTACTCAGGAGGCTGAGGG - Intronic
1059730157 9:117049080-117049102 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1059845854 9:118275907-118275929 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1060663388 9:125417469-125417491 CCAGCTACTCAGGAGGCTGAAGG + Intergenic
1061057018 9:128228866-128228888 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1061151032 9:128828379-128828401 CCAACTACTCGGGGGGCCGAGGG + Intronic
1061242646 9:129383432-129383454 CCTTGAACCCTGGCGGCCGAGGG - Intergenic
1061548145 9:131316523-131316545 CCAACTACTCAGGAGGCTGAGGG + Intergenic
1061558052 9:131384206-131384228 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1061916406 9:133757206-133757228 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1062335552 9:136064172-136064194 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1062429843 9:136522090-136522112 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1062635855 9:137491142-137491164 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1202777600 9_KI270717v1_random:5724-5746 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1185551192 X:983670-983692 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1185567833 X:1109368-1109390 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1185592397 X:1286155-1286177 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1185595053 X:1301214-1301236 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1185862814 X:3594836-3594858 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1186173496 X:6901986-6902008 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1186349648 X:8729510-8729532 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1186837497 X:13452198-13452220 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1187171346 X:16855162-16855184 CCATCTACTCGGGAGGCTGAGGG - Intronic
1187201460 X:17137719-17137741 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1187407991 X:19021760-19021782 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1188887288 X:35566536-35566558 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1189039147 X:37524176-37524198 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1189299822 X:39944370-39944392 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1189776976 X:44478757-44478779 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1189796656 X:44652203-44652225 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1189828085 X:44940918-44940940 CCAGCTACTCGGGAGGCCGAGGG + Intronic
1189832684 X:44990423-44990445 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1189994686 X:46627197-46627219 CTAGCTACTCAGGAGGCCGAGGG + Intronic
1190076096 X:47318219-47318241 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1190169039 X:48096930-48096952 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1190716101 X:53104997-53105019 CCAGCCACTCAGGAGGCTGAAGG - Intergenic
1190798559 X:53767610-53767632 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1190818347 X:53948908-53948930 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1192046648 X:67682397-67682419 CCAGCTACTCAGGAGGCTGAGGG - Intronic
1192431540 X:71115817-71115839 CCAGCTACTCTGGAGGCCGAGGG - Intergenic
1192635180 X:72808852-72808874 CCACCTACTCAGGAGGCTGAGGG + Intronic
1192646535 X:72911951-72911973 CCACCTACTCAGGAGGCTGAGGG - Intronic
1193317536 X:80081059-80081081 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1193910063 X:87293771-87293793 CCAGCTACTCAGGAGGCTGATGG - Intergenic
1193916874 X:87376753-87376775 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1194455091 X:94093970-94093992 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1194494812 X:94600972-94600994 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1194539201 X:95149837-95149859 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1195119500 X:101736182-101736204 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1195246532 X:103000293-103000315 CCAGCTACTCAGGAGGCCAAGGG + Intergenic
1195594761 X:106674907-106674929 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1196253847 X:113492795-113492817 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1196816388 X:119668179-119668201 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1196951763 X:120931589-120931611 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196952447 X:120936450-120936472 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196953132 X:120941311-120941333 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196953817 X:120946171-120946193 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196954502 X:120951032-120951054 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196955185 X:120955892-120955914 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196955872 X:120960775-120960797 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196956554 X:120965636-120965658 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196957236 X:120970496-120970518 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196957918 X:120975356-120975378 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196958600 X:120980216-120980238 CCGTCAACTCAGCCGCCTGATGG - Exonic
1196959281 X:120985076-120985098 CCGTCAACTCAGCCGCCTGATGG - Exonic
1197202832 X:123763703-123763725 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1197229242 X:123985683-123985705 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1197629328 X:128840284-128840306 TCATCAACTCAGGTGGCATATGG + Intergenic
1197761901 X:130033865-130033887 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1198153973 X:133939623-133939645 CCATTAACTCAGGAGACCAAAGG + Intronic
1198176660 X:134163049-134163071 CCATCTACTCAGGAGGCTGAAGG - Intergenic
1198252440 X:134892775-134892797 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1198459768 X:136852034-136852056 CCAGCTACTCAGGAGGCTGAGGG + Intronic
1198471686 X:136952551-136952573 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1198489781 X:137127707-137127729 CCATCAAGACAAGCGGCTGAAGG + Intergenic
1198613696 X:138430463-138430485 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1198780492 X:140229915-140229937 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1198864970 X:141112985-141113007 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1198897714 X:141474406-141474428 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1199086977 X:143639013-143639035 CCAGCCACTCAGGTGGCTGAGGG - Intergenic
1199828633 X:151525960-151525982 CCAGCTACTCAGGAGGCTGAGGG + Intergenic
1200052521 X:153442558-153442580 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1200325508 X:155234233-155234255 CCAGCTACTCAGGAGGCTGAAGG - Intronic
1200848170 Y:7853206-7853228 CCAGCTACTCAGGAGGCTGATGG + Intergenic
1200879897 Y:8202029-8202051 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1201192945 Y:11464009-11464031 CCAGCTACTCAGGAGGCTGAGGG - Intergenic
1201427937 Y:13874844-13874866 CCAGCTACTCAGGTGGCTGAGGG - Intergenic
1201540218 Y:15098126-15098148 CCAGCTACTCAGGAGGCTGATGG - Intergenic
1201579109 Y:15492562-15492584 CCATCTACTCAGGAGGCTGAAGG + Intergenic
1201920323 Y:19226896-19226918 CCATCTACTCAGGAGGCTGAGGG - Intergenic
1202053002 Y:20800244-20800266 CCAGCTACTCAGGAGGCTGAGGG - Intergenic