ID: 1025209693

View in Genome Browser
Species Human (GRCh38)
Location 7:57013539-57013561
Sequence TCCTATTGCCTTCCTGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025209693_1025209706 23 Left 1025209693 7:57013539-57013561 CCCGGGCCAGGAAGGCAATAGGA No data
Right 1025209706 7:57013585-57013607 CCCGACCTGTGGCATCACGTGGG No data
1025209693_1025209698 -7 Left 1025209693 7:57013539-57013561 CCCGGGCCAGGAAGGCAATAGGA No data
Right 1025209698 7:57013555-57013577 AATAGGAGGGCTCCCTAGTCAGG No data
1025209693_1025209709 30 Left 1025209693 7:57013539-57013561 CCCGGGCCAGGAAGGCAATAGGA No data
Right 1025209709 7:57013592-57013614 TGTGGCATCACGTGGGTGTGTGG No data
1025209693_1025209704 22 Left 1025209693 7:57013539-57013561 CCCGGGCCAGGAAGGCAATAGGA No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data
1025209693_1025209701 12 Left 1025209693 7:57013539-57013561 CCCGGGCCAGGAAGGCAATAGGA No data
Right 1025209701 7:57013574-57013596 CAGGCACATCCCCCGACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025209693 Original CRISPR TCCTATTGCCTTCCTGGCCC GGG (reversed) Intergenic
No off target data available for this crispr