ID: 1025209697

View in Genome Browser
Species Human (GRCh38)
Location 7:57013545-57013567
Sequence GAGCCCTCCTATTGCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025209697_1025209709 24 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209709 7:57013592-57013614 TGTGGCATCACGTGGGTGTGTGG No data
1025209697_1025209706 17 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209706 7:57013585-57013607 CCCGACCTGTGGCATCACGTGGG No data
1025209697_1025209711 26 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209711 7:57013594-57013616 TGGCATCACGTGGGTGTGTGGGG No data
1025209697_1025209710 25 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209710 7:57013593-57013615 GTGGCATCACGTGGGTGTGTGGG No data
1025209697_1025209712 29 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209712 7:57013597-57013619 CATCACGTGGGTGTGTGGGGAGG No data
1025209697_1025209701 6 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209701 7:57013574-57013596 CAGGCACATCCCCCGACCTGTGG No data
1025209697_1025209704 16 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025209697 Original CRISPR GAGCCCTCCTATTGCCTTCC TGG (reversed) Intergenic
No off target data available for this crispr