ID: 1025209700

View in Genome Browser
Species Human (GRCh38)
Location 7:57013568-57013590
Sequence GTCGGGGGATGTGCCTGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025209700_1025209704 -7 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data
1025209700_1025209711 3 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209711 7:57013594-57013616 TGGCATCACGTGGGTGTGTGGGG No data
1025209700_1025209706 -6 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209706 7:57013585-57013607 CCCGACCTGTGGCATCACGTGGG No data
1025209700_1025209709 1 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209709 7:57013592-57013614 TGTGGCATCACGTGGGTGTGTGG No data
1025209700_1025209713 25 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209713 7:57013616-57013638 GAGGTCCTGACGTGCCCAGCTGG No data
1025209700_1025209712 6 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209712 7:57013597-57013619 CATCACGTGGGTGTGTGGGGAGG No data
1025209700_1025209710 2 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209710 7:57013593-57013615 GTGGCATCACGTGGGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025209700 Original CRISPR GTCGGGGGATGTGCCTGACT AGG (reversed) Intergenic
No off target data available for this crispr