ID: 1025209704

View in Genome Browser
Species Human (GRCh38)
Location 7:57013584-57013606
Sequence CCCCGACCTGTGGCATCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025209694_1025209704 21 Left 1025209694 7:57013540-57013562 CCGGGCCAGGAAGGCAATAGGAG No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data
1025209693_1025209704 22 Left 1025209693 7:57013539-57013561 CCCGGGCCAGGAAGGCAATAGGA No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data
1025209697_1025209704 16 Left 1025209697 7:57013545-57013567 CCAGGAAGGCAATAGGAGGGCTC No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data
1025209699_1025209704 -6 Left 1025209699 7:57013567-57013589 CCCTAGTCAGGCACATCCCCCGA No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data
1025209700_1025209704 -7 Left 1025209700 7:57013568-57013590 CCTAGTCAGGCACATCCCCCGAC No data
Right 1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025209704 Original CRISPR CCCCGACCTGTGGCATCACG TGG Intergenic
No off target data available for this crispr