ID: 1025209764

View in Genome Browser
Species Human (GRCh38)
Location 7:57013834-57013856
Sequence GAGGGGTCCCTGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025209751_1025209764 10 Left 1025209751 7:57013801-57013823 CCCCTCTCCTCTCAGGGCTCCAG No data
Right 1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG No data
1025209761_1025209764 -9 Left 1025209761 7:57013820-57013842 CCAGGGTTCATGAGGAGGGGTCC No data
Right 1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG No data
1025209756_1025209764 3 Left 1025209756 7:57013808-57013830 CCTCTCAGGGCTCCAGGGTTCAT No data
Right 1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG No data
1025209754_1025209764 8 Left 1025209754 7:57013803-57013825 CCTCTCCTCTCAGGGCTCCAGGG No data
Right 1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG No data
1025209752_1025209764 9 Left 1025209752 7:57013802-57013824 CCCTCTCCTCTCAGGGCTCCAGG No data
Right 1025209764 7:57013834-57013856 GAGGGGTCCCTGATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025209764 Original CRISPR GAGGGGTCCCTGATGGAGGC TGG Intergenic
No off target data available for this crispr