ID: 1025212082

View in Genome Browser
Species Human (GRCh38)
Location 7:57025588-57025610
Sequence CCGGCCCTAAATGGTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025212068_1025212082 27 Left 1025212068 7:57025538-57025560 CCCACCTTGGCCTCCCGAAGTGC 0: 517
1: 31632
2: 134147
3: 235651
4: 217658
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data
1025212076_1025212082 13 Left 1025212076 7:57025552-57025574 CCGAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data
1025212067_1025212082 30 Left 1025212067 7:57025535-57025557 CCTCCCACCTTGGCCTCCCGAAG 0: 383
1: 22898
2: 74835
3: 155012
4: 165925
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data
1025212069_1025212082 26 Left 1025212069 7:57025539-57025561 CCACCTTGGCCTCCCGAAGTGCT 0: 1055
1: 58736
2: 148884
3: 159514
4: 99209
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data
1025212075_1025212082 14 Left 1025212075 7:57025551-57025573 CCCGAAGTGCTGGGATTACAGGC 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data
1025212073_1025212082 17 Left 1025212073 7:57025548-57025570 CCTCCCGAAGTGCTGGGATTACA 0: 5020
1: 297851
2: 269720
3: 207813
4: 298339
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data
1025212071_1025212082 23 Left 1025212071 7:57025542-57025564 CCTTGGCCTCCCGAAGTGCTGGG 0: 1516
1: 84229
2: 207075
3: 235653
4: 165178
Right 1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025212082 Original CRISPR CCGGCCCTAAATGGTTTTAA GGG Intergenic
No off target data available for this crispr