ID: 1025212116

View in Genome Browser
Species Human (GRCh38)
Location 7:57025780-57025802
Sequence CCTCCAAGGCATGCAGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025212108_1025212116 18 Left 1025212108 7:57025739-57025761 CCCTTCTCAGAGGGAGCTGTGTT 0: 3
1: 0
2: 0
3: 21
4: 218
Right 1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG No data
1025212107_1025212116 19 Left 1025212107 7:57025738-57025760 CCCCTTCTCAGAGGGAGCTGTGT 0: 3
1: 0
2: 2
3: 23
4: 259
Right 1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG No data
1025212111_1025212116 -6 Left 1025212111 7:57025763-57025785 CCAAGCCTTGGCTTGCACCTCCA No data
Right 1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG No data
1025212109_1025212116 17 Left 1025212109 7:57025740-57025762 CCTTCTCAGAGGGAGCTGTGTTA 0: 3
1: 0
2: 0
3: 20
4: 139
Right 1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG No data
1025212106_1025212116 22 Left 1025212106 7:57025735-57025757 CCTCCCCTTCTCAGAGGGAGCTG 0: 3
1: 0
2: 6
3: 48
4: 790
Right 1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG No data
1025212105_1025212116 23 Left 1025212105 7:57025734-57025756 CCCTCCCCTTCTCAGAGGGAGCT 0: 3
1: 0
2: 1
3: 25
4: 302
Right 1025212116 7:57025780-57025802 CCTCCAAGGCATGCAGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025212116 Original CRISPR CCTCCAAGGCATGCAGTGGA CGG Intergenic
No off target data available for this crispr