ID: 1025212220

View in Genome Browser
Species Human (GRCh38)
Location 7:57026270-57026292
Sequence GGTGAGCTGCAGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025212214_1025212220 -9 Left 1025212214 7:57026256-57026278 CCCACCACAGACTGGGTGAGCTG 0: 3
1: 0
2: 2
3: 16
4: 203
Right 1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG No data
1025212215_1025212220 -10 Left 1025212215 7:57026257-57026279 CCACCACAGACTGGGTGAGCTGC No data
Right 1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025212220 Original CRISPR GGTGAGCTGCAGAGGGAGGA TGG Intergenic
No off target data available for this crispr