ID: 1025212220 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:57026270-57026292 |
Sequence | GGTGAGCTGCAGAGGGAGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1025212214_1025212220 | -9 | Left | 1025212214 | 7:57026256-57026278 | CCCACCACAGACTGGGTGAGCTG | 0: 3 1: 0 2: 2 3: 16 4: 203 |
||
Right | 1025212220 | 7:57026270-57026292 | GGTGAGCTGCAGAGGGAGGATGG | No data | ||||
1025212215_1025212220 | -10 | Left | 1025212215 | 7:57026257-57026279 | CCACCACAGACTGGGTGAGCTGC | No data | ||
Right | 1025212220 | 7:57026270-57026292 | GGTGAGCTGCAGAGGGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1025212220 | Original CRISPR | GGTGAGCTGCAGAGGGAGGA TGG | Intergenic | ||
No off target data available for this crispr |