ID: 1025213053

View in Genome Browser
Species Human (GRCh38)
Location 7:57032160-57032182
Sequence AGCACTCCCTGGTTTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025213053_1025213059 16 Left 1025213053 7:57032160-57032182 CCCCCAGGAAACCAGGGAGTGCT No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data
1025213053_1025213064 27 Left 1025213053 7:57032160-57032182 CCCCCAGGAAACCAGGGAGTGCT No data
Right 1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG No data
1025213053_1025213061 20 Left 1025213053 7:57032160-57032182 CCCCCAGGAAACCAGGGAGTGCT No data
Right 1025213061 7:57032203-57032225 ACCCACACTTTGCATATGGAGGG No data
1025213053_1025213060 19 Left 1025213053 7:57032160-57032182 CCCCCAGGAAACCAGGGAGTGCT No data
Right 1025213060 7:57032202-57032224 AACCCACACTTTGCATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025213053 Original CRISPR AGCACTCCCTGGTTTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr