ID: 1025213056

View in Genome Browser
Species Human (GRCh38)
Location 7:57032163-57032185
Sequence TGCAGCACTCCCTGGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025213056_1025213061 17 Left 1025213056 7:57032163-57032185 CCAGGAAACCAGGGAGTGCTGCA No data
Right 1025213061 7:57032203-57032225 ACCCACACTTTGCATATGGAGGG No data
1025213056_1025213064 24 Left 1025213056 7:57032163-57032185 CCAGGAAACCAGGGAGTGCTGCA No data
Right 1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG No data
1025213056_1025213060 16 Left 1025213056 7:57032163-57032185 CCAGGAAACCAGGGAGTGCTGCA No data
Right 1025213060 7:57032202-57032224 AACCCACACTTTGCATATGGAGG No data
1025213056_1025213059 13 Left 1025213056 7:57032163-57032185 CCAGGAAACCAGGGAGTGCTGCA No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025213056 Original CRISPR TGCAGCACTCCCTGGTTTCC TGG (reversed) Intergenic
No off target data available for this crispr