ID: 1025213059

View in Genome Browser
Species Human (GRCh38)
Location 7:57032199-57032221
Sequence CACAACCCACACTTTGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025213053_1025213059 16 Left 1025213053 7:57032160-57032182 CCCCCAGGAAACCAGGGAGTGCT No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data
1025213055_1025213059 14 Left 1025213055 7:57032162-57032184 CCCAGGAAACCAGGGAGTGCTGC No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data
1025213057_1025213059 5 Left 1025213057 7:57032171-57032193 CCAGGGAGTGCTGCACACGTGAA No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data
1025213056_1025213059 13 Left 1025213056 7:57032163-57032185 CCAGGAAACCAGGGAGTGCTGCA No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data
1025213054_1025213059 15 Left 1025213054 7:57032161-57032183 CCCCAGGAAACCAGGGAGTGCTG No data
Right 1025213059 7:57032199-57032221 CACAACCCACACTTTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025213059 Original CRISPR CACAACCCACACTTTGCATA TGG Intergenic
No off target data available for this crispr