ID: 1025216916

View in Genome Browser
Species Human (GRCh38)
Location 7:57064325-57064347
Sequence CCTGTATGGAGGTTAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025216916_1025216923 21 Left 1025216916 7:57064325-57064347 CCATCCACTAACCTCCATACAGG No data
Right 1025216923 7:57064369-57064391 GGATATAAGAAGCACTTAGATGG No data
1025216916_1025216922 0 Left 1025216916 7:57064325-57064347 CCATCCACTAACCTCCATACAGG No data
Right 1025216922 7:57064348-57064370 GATGCAAGATACATTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025216916 Original CRISPR CCTGTATGGAGGTTAGTGGA TGG (reversed) Intergenic