ID: 1025216916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:57064325-57064347 |
Sequence | CCTGTATGGAGGTTAGTGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1025216916_1025216923 | 21 | Left | 1025216916 | 7:57064325-57064347 | CCATCCACTAACCTCCATACAGG | No data | ||
Right | 1025216923 | 7:57064369-57064391 | GGATATAAGAAGCACTTAGATGG | No data | ||||
1025216916_1025216922 | 0 | Left | 1025216916 | 7:57064325-57064347 | CCATCCACTAACCTCCATACAGG | No data | ||
Right | 1025216922 | 7:57064348-57064370 | GATGCAAGATACATTCTCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1025216916 | Original CRISPR | CCTGTATGGAGGTTAGTGGA TGG (reversed) | Intergenic | ||