ID: 1025216922

View in Genome Browser
Species Human (GRCh38)
Location 7:57064348-57064370
Sequence GATGCAAGATACATTCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025216915_1025216922 4 Left 1025216915 7:57064321-57064343 CCAACCATCCACTAACCTCCATA No data
Right 1025216922 7:57064348-57064370 GATGCAAGATACATTCTCTAAGG No data
1025216916_1025216922 0 Left 1025216916 7:57064325-57064347 CCATCCACTAACCTCCATACAGG No data
Right 1025216922 7:57064348-57064370 GATGCAAGATACATTCTCTAAGG No data
1025216914_1025216922 19 Left 1025216914 7:57064306-57064328 CCGTTTCTGTGGCTTCCAACCAT No data
Right 1025216922 7:57064348-57064370 GATGCAAGATACATTCTCTAAGG No data
1025216919_1025216922 -4 Left 1025216919 7:57064329-57064351 CCACTAACCTCCATACAGGGATG No data
Right 1025216922 7:57064348-57064370 GATGCAAGATACATTCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025216922 Original CRISPR GATGCAAGATACATTCTCTA AGG Intergenic