ID: 1025216923

View in Genome Browser
Species Human (GRCh38)
Location 7:57064369-57064391
Sequence GGATATAAGAAGCACTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025216921_1025216923 7 Left 1025216921 7:57064339-57064361 CCATACAGGGATGCAAGATACAT No data
Right 1025216923 7:57064369-57064391 GGATATAAGAAGCACTTAGATGG No data
1025216915_1025216923 25 Left 1025216915 7:57064321-57064343 CCAACCATCCACTAACCTCCATA No data
Right 1025216923 7:57064369-57064391 GGATATAAGAAGCACTTAGATGG No data
1025216919_1025216923 17 Left 1025216919 7:57064329-57064351 CCACTAACCTCCATACAGGGATG No data
Right 1025216923 7:57064369-57064391 GGATATAAGAAGCACTTAGATGG No data
1025216916_1025216923 21 Left 1025216916 7:57064325-57064347 CCATCCACTAACCTCCATACAGG No data
Right 1025216923 7:57064369-57064391 GGATATAAGAAGCACTTAGATGG No data
1025216920_1025216923 10 Left 1025216920 7:57064336-57064358 CCTCCATACAGGGATGCAAGATA No data
Right 1025216923 7:57064369-57064391 GGATATAAGAAGCACTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025216923 Original CRISPR GGATATAAGAAGCACTTAGA TGG Intergenic