ID: 1025223915

View in Genome Browser
Species Human (GRCh38)
Location 7:57140105-57140127
Sequence CTCTCTCCACAGTTGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025223911_1025223915 -5 Left 1025223911 7:57140087-57140109 CCAAACTTTGTTCCTGGTCTCTC No data
Right 1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG No data
1025223908_1025223915 5 Left 1025223908 7:57140077-57140099 CCCAGGAGATCCAAACTTTGTTC No data
Right 1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG No data
1025223909_1025223915 4 Left 1025223909 7:57140078-57140100 CCAGGAGATCCAAACTTTGTTCC No data
Right 1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG No data
1025223907_1025223915 11 Left 1025223907 7:57140071-57140093 CCAGCACCCAGGAGATCCAAACT No data
Right 1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025223915 Original CRISPR CTCTCTCCACAGTTGGAATT GGG Intergenic
No off target data available for this crispr